The Analysis of Milk Components and Pathogenic Bacteria Isolated from Bovine Raw Milk in Korea
Article Outline
- Abstract
- Introduction
- Materials and Methods
- Results And Discussion
- Changes in Bovine Raw Milk Components in Korea
- Relationships Among Percentages of Milk Fat, Protein, Lactose, and MUN by SCCt
- Relationships Among the Percentages of Milk Fat, Protein, Lactose, and SCCt by MUN
- Relationships Between SCCt or MUN and Milk Components According to the Bacterial Species Isolated
- Conclusions
- Acknowledgments
- Supplementary data
- References
- Copyright
Abstract
Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (−0.0149), lactose (−0.8910), and MUN (−0.0096), and those of MUN on milk fat (−0.3125), protein (−0.8012), and SCCt (−0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (−0.0172), protein (−0.2693), and lactose (−0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.
Key words: bovine mastitis, somatic cell count, milk urea nitrogen, Staphylococcus aureus
Introduction
Mastitis is an inflammation of the mammary glands of dairy cows that can be caused by physical or chemical agents, with the majority of cases caused by bacterial infection. Mastitis is the most common and expensive disease affecting the dairy industry worldwide (Harmon, 1994; Quinn et al., 1994; Moussaoui et al., 2004). In Korea, there are approximately 8,000 dairy farms and 472,000 cows, yielding an average of 177,770,000
kg of raw milk per year. The degree of self-sufficiency of milk produced in Korea is approximately 70% (Korea Dairy Committee, 2007), so managing and preventing bovine mastitis is an inevitable task.
One indicator of bacterial infection of the mammary glands is an increase in SCC, which has been used to monitor mastitis in dairy cows (O’Brien et al., 2001). Milk urea nitrogen is an indicator of protein utilization (Jonker et al., 1999) and can be increased by excessive feeding of protein (Broderick and Clayton, 1997). Therefore, SCC and MUN have become good management tools for predicting and diagnosing mastitis and for monitoring the use of protein and the improvement in milk quality (Harmon, 1994; Jonker et al., 2002).
Elevated SCC has been associated with a decrease in the percentages of lactose and fat in milk (Harmon, 1994). Mammary epithelial cells can be damaged by bacteria, resulting in a reduced ability to synthesize milk components. Moreover, MUN has been inversely associated with percentages of milk protein and fat and with SCC (Eicher et al., 1999; Godden et al., 2001; Johnson and Young, 2003).
More than 130 microorganisms are related to bovine mastitis, with mastitis-causing bacteria broadly classified as contagious or environmental pathogens (Watts, 1988; Quinn et al., 1994). Contagious pathogens such as Staphylococcus aureus and Streptococcus agalactiae can be transmitted from cow to cow (Bradley, 2002), whereas environmental pathogens, such as Streptococcus dysgalactiae, Streptococcus uberis, Enterococcus spp., CNS, and gram-negative enteric bacilli (Pseudomonas spp., Escherichia coli) can be transmitted during milking from the contaminated environment (Watts, 1988).
The objectives of this study were to examine and predict the quality of raw milk by analyzing SCC, MUN, and milk components of Holstein cows in Korea. We investigated the associations among SCC, MUN, and milk components based on the presence of bacteria and the bacterial species isolated from these raw milk samples.
Materials and Methods
Milk Sampling and Analysis
From March 2003 to March 2006, a total of 30,019 bovine raw milk samples were randomly collected from 390 farms in 9 provinces in Korea. Teat ends were cleaned with 4% chlorhexidine before sampling. The first few milliliters of milk were discarded, and then quantities of 20 to 50
mL of milk were collected aseptically into sterile vials. Milk samples were transported on ice to the laboratory and kept at 4°C until bacteriological assays and analysis of SCC, MUN, and milk components. Somatic cell counts and MUN were determined by Somacount 150 and Chemspec 150 instruments (Bentley Instruments Inc., Chaska, MN), respectively. The percentages of milk components, including milk fat, milk protein, and lactose, were analyzed by using a Bentley 150 instrument (Bentley Instruments Inc.).
Somatic cell count values were sorted into 5 categories: <200
×
103
cells/mL (grade 1); 200 to 349
×
103
cells/mL (grade 2); 350 to 499
×
103
cells/mL (grade 3); 500 to 750
×
103
cells/mL (grade 4); and >751
×
103
cells/mL (grade 5). Milk urea nitrogen was sorted in increments of 2 mg/dL; samples with MUN ≤6 mg/dL were grouped into one category, and those with MUN ≥24 mg/dL into another category (Johnson and Young, 2003).
Isolation and Identification of Bacteria
Ten microliters of each milk sample was streaked onto 5% sheep blood agar plates (Promed, Sungnam, Gyeonggi, Korea) and incubated at 37°C for 24
h. Colonies were initially assessed by their morphology and hemolysis patterns, followed by gram staining and motility tests. Biochemical tests, specifically, catalase, oxidase, coagulase, growth in 6.5 or 10% NaCl, esculin hydrolysis, carbohydrate (glucose, mannitol, ribose, sorbitol, and trehalose) fermentation tests, biochemical reaction on MacConkey agar (Becton Dickinson and Co., Sparks, MD), indole production, Lys decarboxylation, urease production, and citrate utilization tests, were performed as required.
Determination of the Identified Bacteria by PCR
The identification of Staph. aureus, Strep. dysgalactiae, Strep. uberis, and Enterococcus spp. were further confirmed by PCR by using species-specific primers (Brakstad et al., 1992; Forsman et al., 1997; Martineau et al., 1998; Ke et al., 1999; Table 1). Chromosomal DNA was extracted by the guanidine thiocyanate method. Briefly, after culturing in 5% sheep blood agar, a single colony was inoculated into 3
mL of trypticase soy broth (Becton Dickinson and Co.) and incubated at 37°C for 24
h. The broth culture was centrifuged for 10
min at 6,000
×
g in a 1.5-mL microcentrifuge tube, and the pellet was resuspended in 200
μL of enzymatic lysis buffer [10
mM Tris-HCl, 1
mM EDTA, pH 8.0, 1.2% Triton X-100, and 18
μg of lysozyme (Sigma-Aldrich, St. Louis, MO)]. In cases in which streptococcal isolates were suspected, 2.5 U/mL of mutanolysin (Sigma-Ald-rich) was added. For Staph. aureus, the pellet was re-suspended in 1
mL of TE buffer (10
mM Tris-HCl and 1
mM EDTA, pH 8.0) containing 100 U/mL of lysostaphin (Sigma-Aldrich), to which 40
μL of diatomaceous earth suspension [10
g of diatomaceous earth (Sigma-Ald-rich), 50
mL of tertiary distilled water, and 500
μL of 32% HCl (wt/vol)] was added. The suspension was mixed by vortexing, incubated at room temperature for 10
min, and centrifuged for 2
min at 20,000
×
g. The pellet was washed with a second washing buffer [120
g of guanidine thiocyanate (Amresco, Solon, OH) and 100
mL of 0.1 M Tris HCl (pH 6.4)], serially washed with 70% ethanol and 100% acetone, and incubated at 56°C for 10
min. The DNA was eluted in 200
μL of Tris-EDTA buffer and incubated at 56°C for 10
min. The supernatant was transferred to a new tube after centrifugation for 2
min at 20,000
×
g.
Table 1. Species-specific PCR primers for Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus uberis, and Enterococcus spp.
| Bacteria | Target gene or fragment | Primer | Nucleotide sequences (5′ → 3′) | Amplicon size (bp) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|---|
| Staph. aureus | sa442 | sa442 | GGGAAAACGACAATTGC | 100 | 55 | Martineau et al., 1998 |
| sa442 R | GTACAATGCGGCCGTTA | |||||
| nuc | nuc F | GCGATTGATTGATGGTGATACGGTT | 279 | 55 | Brakstad et al., 1992 | |
| nuc R | AGCCAAGCCTTGACGAACTAAAGC | |||||
| Strep. dysgalactiae | sdys | sdys F | TGGAACACGTTAGGGTCG | 270 | 52 | Forsman et al., 1997 |
| sdys R | CTTTTACTAGTATATCTTAA | |||||
| Strep. uberis | sub | sub F | TAAGGAACACGTTGGTTAAG | 330 | 55 | Forsman et al., 1997 |
| sub R | TCCAGTCCTTAGACCTTCT | |||||
| Enterococcus spp. | ent | ent F | TACTGACAAACCATT | 100 | 55 | Ke et al., 1999 |
| ent R | AACTTCGTCACCAAC |
Polymerase chain reaction was performed in a Mastercycler Gradient Thermal Cycler (Eppendorf Mastercycler Gradient, Hamburg, Germany), and all reagents were purchased from Takara Bio Inc. (Otsu, Shiga, Japan). Each PCR reaction mixture was made up to a final volume of 20
μL, consisting of 13.7
μL of distilled water, 0.4
μL of each primer (10 pmol/μL; Table 1), 1.6
μL of 2.5
mM dNTP, 1.2
μL of 25
mM MgCl2, 2
μL of 10× buffer, 5 U of Taq polymerase (0.1
μL), and 1
μL of template DNA. The amplification protocol consisted of an initial denaturation at 94°C for 5
min, followed by 30 cycles of denaturation at 94°C for 30
s, annealing at 52 or 55°C for 30
s, and extension at 72°C for 1
min, followed by a final extension at 72°C for 7
min (Table 1). The PCR products were electrophoresed on 1.5% agarose gels, made with 0.5× TBE (0.89 M Tris, 0.89 M boric acid, 0.02 M EDTA, pH 8.0), at 110
V for 1
h. The gels were stained with ethidium bromide (0.5
μg/mL) and visualized under a UV transilluminator.
Statistical Analysis
Statistical analysis was performed with the SPSS program (version 11.5.0, SPSS Inc., Chicago, IL). For the analysis of SCC, values were naturally logarithmically transformed [SCCt = ln(SCC)]. Multilinear regression models in SPSS were used to investigate the associations between SCCt or MUN and the percentages of milk fat, milk protein, and lactose. The model was:

and

In addition, the associations among all variables and the differences among milk samples were analyzed according to the presence or absence of bacterial infection in milk. The general effects were estimated (Hojman et al., 2004) by univariate GLM, presented as:

and

For analysis of the relationship between SCCt or MUN and milk components according to the bacterial species isolated, the milk samples from which >2 bacterial species were isolated were not included in the analysis. The level of significance was set at P
<
0.05.
Results And Discussion
Changes in Bovine Raw Milk Components in Korea
The levels of SCC and MUN in bovine raw milk are summarized in Table 2. There was a decrease in SCC (SCCt) and MUN (P
<
0.001) during the study period. Grade 1 milk (SCC <200
×
103 cells/mL) proportions did not change over time and ranged from 64% in 2003 to 70% in 2006 (Table 2).
Table 2. Yearly patterns of milk components and SCC of bovine raw milk on Korean dairy farms
| Year | Milk samples (n) | Milk fat (%) | Milk protein (%) | Lactose (%) | MUN (mg/dL) | SCC (×103 cells/mL) | SCCt1 (lnSCC) | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | Milk with SCC grade 12 (%) | ||
| 2003 | 8,475 | 3.71c | 0.02 | 3.15d | 0.00 | 4.82c | 0.00 | 15.92a | 0.04 | 295a | 6.01 | 4.87a | 0.01 | 64 |
| 2004 | 8,335 | 3.88a | 0.01 | 3.24b | 0.00 | 4.84a | 0.01 | 14.89b | 0.04 | 234b | 4.74 | 4.70b | 0.01 | 70 |
| 2005 | 10,360 | 3.74bc | 0.01 | 3.19c | 0.00 | 4.84ab | 0.00 | 14.99b | 0.03 | 224b | 4.76 | 4.52c | 0.01 | 72 |
| 2006 | 2,849 | 3.80b | 0.02 | 3.28a | 0.01 | 4.81cd | 0.00 | 14.20c | 0.07 | 234b | 9.33 | 4.59c | 0.02 | 70 |
| Total | 30,019 | 3.78 | 0.01 | 3.20 | 0.00 | 4.83 | 0.00 | 15.15 | 0.02 | 248 | 2.85 | 4.68 | 0.01 | 69 |
a–dMeans within a column with different superscripts differ (one-way ANOVA, P |
1SCCt = natural logarithmic-transformed SCC. |
2Grade 1 = milk with SCC <200 |
Milk urea nitrogen is a quick and accurate reflection of nitrogen absorption by cattle, suggesting that this trait may serve as a guide for identifying the diets provided to these animals. Monthly variations between SCCt and lactose percentage, and between MUN and milk protein percentage are shown in Figure 1. The monthly variation in SCCt during the year, except for July, was inversely related to the percentage of lactose (Figure 1A), and the variation between SCCt and milk fat percentage had patterns similar to those between SCCt and lactose percentage (data not shown). Milk urea nitrogen during the year was a mirror image of the increases and decreases in percentage of milk protein (Figure 1B). The same pattern was observed between MUN and percentage of milk fat (data not shown). A seasonal trend of SCCt in Korea was distinct (Figure 1A). The SCCt increased with increases in temperature and humidity from late summer to fall (from August to October), whereas it decreased from winter to spring (from December to May, except in March; P
<
0.001). This seasonal trend is similar to a report from Canada (Sargeant et al., 1998) and supports literature dealing with heat stress and its detrimental effects on milk production and udder health; SCC in milk was higher in heat-stressed cows (Elvinger et al., 1991). Milk urea nitrogen was low during the fall and high during the other seasons, except in February, and milk protein percentages decreased from spring to summer and then continuously increased until winter. We observed decreased MUN within its optimal range (Moon et al., 2000; Figure 2).

Figure 1.
Monthly variation between natural logarithmic-transformed SCC (SCCt, ▵) and concentration of lactose (■, A), and variation between MUN (▵) and concentration of protein (■, B).

Figure 2.
The relationship between MUN and the natural logarithmic-transformed SCC (SCCt). The quadratic function approximating the observed values on the SCCt and MUN axes is shown with its equation. The dotted rectangle shows the optimal MUN concentrations (12 to 18 mg/dL).
Regionally, there were statistical differences in SCC, MUN, milk fat, milk protein, and lactose (Table 3). Jeju Island, located in the southern part of Korea, showed the lowest SCC (215
×
103
cells/mL) and MUN (14.29 mg/dL) values compared with the other regions. Jeju Island has a mild climate and low humidity, and cattle grazing is more common compared with the other regions. For MUN, similar values were observed across neighboring regions (Jeonbuk and Jeonnam, Gyeongbuk and Gyeongnam, and Gangwon and Gyeonggi), except for the Chungbuk and Chungnam regions. Lactose percentages among regions were not different. Percentages of milk fat in Chungnam, Gyeongbuk, and Jeonnam and milk protein in Gangwon, Gyeongbuk, and Gyeonggi were higher compared with those in the other regions.
Table 3. Regional patterns of milk components and SCC of bovine raw milk on Korean dairy farms
| Region | Milk (n) | Milk fat (%) | Milk protein (%) | Lactose (%) | MUN (mg/dL) | SCC (×103 cells/mL) | SCCt2 (ln SCC) | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | ||
| Chungbuk | 1,403 | 3.68bce | 0.03 | 3.19ce | 0.01 | 4.83ac | 0.01 | 16.54a | 0.1 | 271c | 12.59 | 4.79ab | 0.04 |
| Chungnam | 7,475 | 3.86a | 0.02 | 3.18bcg | 0.00 | 4.83ab | 0.01 | 14.58bf | 0.04 | 242cd | 5.3 | 4.73bd | 0.01 |
| Gangwon | 1,346 | 3.77ac | 0.03 | 3.27a | 0.01 | 4.86a | 0.01 | 15.78b | 0.09 | 334a | 20.29 | 4.76c | 0.04 |
| Gyeongbuk | 4,823 | 3.85b | 0.01 | 3.24bc | 0.00 | 4.83ac | 0.00 | 15.55ae | 0.05 | 236ae | 6.63 | 4.66ae | 0.02 |
| Gyeonggi | 2,164 | 3.63be | 0.03 | 3.24ab | 0.01 | 4.81abc | 0.01 | 15.01ae | 0.07 | 281ab | 11.72 | 4.82a | 0.03 |
| Gyeongnam | 4,221 | 3.7acd | 0.02 | 3.19ad | 0.01 | 4.84b | 0.00 | 15.14ae | 0.05 | 228ce | 7.36 | 4.57abe | 0.02 |
| Jeju | 3,229 | 3.75cd | 0.02 | 3.16ah | 0.01 | 4.84a | 0.00 | 14.29g | 0.06 | 215af | 7.18 | 4.53cf | 0.02 |
| Jeonbuk | 1,290 | 3.68be | 0.03 | 3.19af | 0.01 | 4.79abc | 0.01 | 15.61d | 0.09 | 332ab | 20.72 | 4.72abd | 0.04 |
| Jeonnam | 4,068 | 3.8ac | 0.02 | 3.22ad | 0.01 | 4.82abc | 0.00 | 15.66c | 0.05 | 238ad | 6.86 | 4.68abd | 0.02 |
| Total | 30,019 | 3.78 | 0.01 | 3.2 | 0.00 | 4.83 | 0.01 | 15.15 | 0.02 | 264 | 2.85 | 4.68 | 0.01 |
a–hMeans within a column with different superscripts differ (one-way ANOVA, P |
Relationships Among Percentages of Milk Fat, Protein, Lactose, and MUN by SCCt
Differences in Milk Components and MUN by SCCtThe values for milk fat, milk protein, lactose, MUN, and SCC (SCCt) over a 4-yr period are shown in Table 2. Milk with SCC <500
×
103
cells/mL had greater percentages of milk components and MUN (P
<
0.001) compared with milk containing >500
×
103
cells/mL (Table 4). As the SCC grade increased, lactose percentage and MUN decreased (P
<
0.001; Table 4). In contrast, the percentages of milk fat and protein increased between grades 1 and 2, but decreased between grades 3 and 5. In mastitis, the increased permeability of the blood-milk mammary epithelial barrier associated with initiation of inflammation leads to an influx of serum proteins, including lactoferrin, BSA, and IgG, into milk (Moussaoui et al., 2004). According to Urech et al. (1999), this increased proportion of serum proteins compensates for the significantly lower proportion of CN in total protein in the milk from quarters with subclinical mastitis.
Table 4. Means of milk components and transformed SCC (SCCt) grouped according to SCC level and grade on Korean dairy farms
| Grade | SCC (×103 cells/mL) | Milk samples (n) | SCCt1 (lnSCC) | Milk fat (%) | Milk protein (%) | Lactose (%) | MUN (mg/dL) | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | |||
| <500 | 26,747 | 4.41b | 0.01 | 3.79a | 0.01 | 3.2a | 0 | 4.85a | 0 | 15.17a | 0.02 | |
| ≥500 | 3,272 | 6.88a | 0.01 | 3.65b | 0.02 | 3.15b | 0.01 | 4.63b | 0.01 | 14.99b | 0.06 | |
| 1 | <200 | 20,720 | 4.03e | 0.01 | 3.78ab | 0.01 | 3.2bc | 0 | 4.88a | 0 | 15.2a | 0.02 |
| 2 | 201–350 | 4,139 | 5.56d | 0 | 3.86a | 0.02 | 3.26a | 0.01 | 4.78b | 0.01 | 15.08ab | 0.05 |
| 3 | 351–500 | 1,888 | 6.03c | 0 | 3.82a | 0.03 | 3.24ab | 0.01 | 4.73c | 0.01 | 14.98b | 0.08 |
| 4 | 501–750 | 1,458 | 6.4b | 0 | 3.78a | 0.04 | 3.22b | 0.01 | 4.68d | 0.01 | 15.05b | 0.09 |
| 5 | >750 | 1,814 | 7.27a | 0.01 | 3.54c | 0.03 | 3.08d | 0.01 | 4.58e | 0.01 | 14.94b | 0.08 |
| Total | 30,019 | 4.68 | 0.01 | 3.78 | 0.01 | 3.2 | 0 | 4.83 | 0 | 15.15 | 0.02 | |
a–eMeans within a column with different superscripts differ (one-way ANOVA, P |
1SCCt = the natural logarithmic-transformed SCC. |
In our regression model, all of the variables (i.e., percentages of milk fat, milk protein, and lactose and MUN) influenced SCCt (P
<
0.001). There were negative relationships between SCCt and milk fat (b = −0.0149), lactose (b = −0.8910), and MUN (b = −0.0096), similar to those shown previously (Welper and Freeman, 1992; Harmon, 1994), yet we found a positive relationship between SCCt and milk protein percentage (b = 0.3023). Although we did not analyze each milk protein, such as CN, whey, and nonprotein nitrogen, the positive relationship observed between them may be due to an increase in whey protein in raw milk. According to Leitner et al. (2004), milk protein concentrations, especially concentrations of whey protein, were higher in infected than in uninfected glands, and there were no differences in CN concentrations.
Using a univariate GLM, we analyzed the relationships between SCCt and the percentages of milk fat, milk protein, and lactose and MUN after categorizing them into 2 groups based on the presence or absence of bacterial infection in milk samples (Table 5). Most of the variables included in the model significantly influenced SCCt (P
<
0.001, R2 = 0.281). When bacteria were not present in milk, there were positive associations between SCCt and percentages of milk fat (b = 0.0177) and protein (b = 0.4275) and a negative association between SCCt and the percentage of lactose (b =−0.6886; P
<
0.001). The relationship between SCCt and MUN was not significant. When bacteria were present in milk, the relationships between SCCt and the percentages of milk protein (b = −0.2693) and lactose (b =−0.4108) were negative (P
<
0.001). The SCCt values were significantly higher in May (b = −0.2257), June (b = 0.0851), July (b = 0.2238), August (b = 0.3593), September (b = 0.2838), October (b = 0.2180), and November (b = −0.0875) than in the other months.
Table 5. The relationship between the natural logarithmic-transformed SCC (SCCt) and milk components on Korean dairy farms categorized by the presence or absence of bacteria and the month of milk sampling and analyzed by univariate GLM
| Effect | Estimate | SE | P | |
|---|---|---|---|---|
| Intercept1 | 9.3052 | 0.3346 | 0.001 | |
| Intercept | [ISOLATE=0]2 | −2.9768 | 0.3509 | 0.001 |
| [ISOLATE=1]3 | 0.0000 | |||
| Regression coefficient4 | [ISOLATE=0] | 0.0177 | 0.006 | 0.003 |
| [ISOLATE=1] | −0.0172 | 0.0174 | 0.323 | |
| [ISOLATE=0] | 0.4275 | 0.0193 | 0.001 | |
| [ISOLATE=1] | −0.2693 | 0.0721 | 0.001 | |
| [ISOLATE=0] | −0.6886 | 0.0186 | 0.001 | |
| [ISOLATE=1] | −0.4108 | 0.0546 | 0.001 | |
| [ISOLATE=0] | 0.0003 | 0.0021 | 0.868 | |
| [ISOLATE=1] | 0.013 | 0.0065 | 0.045 | |
| Month of sampling | ||||
| Intercept | January | 0.0137 | 0.0301 | 0.650 |
| February | −0.0435 | 0.031 | 0.161 | |
| March | 0.0557 | 0.0284 | 0.050 | |
| April | 0.0134 | 0.0283 | 0.636 | |
| May | −0.2257 | 0.0305 | 0.001 | |
| June | 0.0851 | 0.0301 | 0.005 | |
| July | 0.2238 | 0.0314 | 0.001 | |
| August | 0.3593 | 0.0337 | 0.001 | |
| September | 0.2838 | 0.0345 | 0.001 | |
| October | 0.218 | 0.0298 | 0.001 | |
| November | −0.0875 | 0.0322 | 0.007 | |
| December | 0.0000 |
1Means of the explained variable (SCCt). |
2Raw milk samples of cattle with no bacterial infection. |
3Raw milk samples of cattle with bacterial infection. |
4Relationship of each milk component with the explained variable (SCCt) is presented as a slope. |
Relationships Among the Percentages of Milk Fat, Protein, Lactose, and SCCt by MUN
Differences in Milk Components and SCCt by MUNAs MUN increased, the percentages of milk fat and protein decreased (P
<
0.001) regardless of bacterial infection (Table 6). Negative nonlinear associations between MUN and the percentages of milk fat and protein have been reported (Godden et al., 2001). There was no relationship between MUN and lactose.
Table 6. Means of milk components and transformed SCC (SCCt) grouped according to MUN level on Korean dairy farms
| MUN level (mg/dL) | Milk samples (n) | Milk fat (%) | Milk protein (%) | Lactose (%) | SCC (×103 cells/mL) | SCCt1 (lnSCC) | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | ||
| ≤6.00 | 169 | 4.24a | 0.13 | 3.38a | 0.09 | 4.75a | 0.03 | 389a | 79.53 | 4.89ab | 0.10 |
| 6.01–8.00 | 403 | 4.08a | 0.06 | 3.29a | 0.02 | 4.81a | 0.01 | 335ab | 35.09 | 4.91a | 0.07 |
| 8.01–10.00 | 1,174 | 4.05a | 0.04 | 3.26a | 0.01 | 4.81a | 0.01 | 260abc | 13.17 | 4.79ab | 0.04 |
| 10.01–12.00 | 3,065 | 3.97a | 0.02 | 3.26a | 0.01 | 4.83a | 0.01 | 277ab | 10.05 | 4.76ab | 0.02 |
| 12.01–14.00 | 5,783 | 3.88b | 0.01 | 3.23b | 0.00 | 4.83a | 0.00 | 250c | 6.72 | 4.67bcd | 0.02 |
| 14.01–16.00 | 8,410 | 3.79c | 0.01 | 3.21c | 0.00 | 4.84a | 0.00 | 248c | 5.37 | 4.70b | 0.01 |
| 16.01–18.00 | 5,765 | 3.69d | 0.02 | 3.19c | 0.00 | 4.84a | 0.01 | 224c | 5.55 | 4.62ad | 0.02 |
| 18.01–20.00 | 3,192 | 3.59e | 0.02 | 3.15d | 0.01 | 4.82a | 0.00 | 234c | 7.92 | 4.61ad | 0.02 |
| 20.01–22.00 | 1,383 | 3.50ef | 0.03 | 3.11e | 0.01 | 4.82a | 0.01 | 248bc | 13.54 | 4.60abd | 0.04 |
| 22.01–24.00 | 473 | 3.36f | 0.05 | 3.09e | 0.01 | 4.80a | 0.01 | 259abc | 24.69 | 4.68abc | 0.06 |
| >24.00 | 202 | 3.26f | 0.07 | 3.03e | 0.02 | 4.81a | 0.02 | 244ac | 32.45 | 4.83ab | 0.08 |
| Total | 30,019 | 3.78 | 0.01 | 3.20 | 0.00 | 4.83 | 0.00 | 248 | 2.85 | 4.68 | 0.01 |
a–fMeans within a column with different superscripts differ (one-way ANOVA, P |
1SCCt = the natural logarithmic-transformed SCC. |
The relationship between SCCt and MUN could be separated into 2 phases (Figure 2). Up to a MUN concentration of 16 mg/dL, SCCt was inversely related to MUN. Afterward, SCCt increased as MUN concentrations increased. Various relationships between SCC and MUN have been reported: either a significant linear association (Johnson and Young, 2003), a slightly negative relationship (Godden et al., 2001), or no relationship at all (Eicher et al., 1999). At optimal MUN (12 to 18 mg/dL), SCCt was lowest (Moon et al., 2000). This association may be due to a relationship between nutrition and the immune response of cattle. The SCC, a marker for immune status, increased as MUN deviated from optimal concentrations, reflecting the nutritional status of cattle.
Relationships Between MUN and Milk ComponentsAll of the variables included in the regression model influenced MUN (P
<
0.001), except for percentage of lactose (P
>
0.05). There were significant negative associations between MUN and milk fat (b = −0.3125), milk protein (b = −0.8012), and SCCt (b = −0.0671), as shown previously (Godden et al., 2001; Johnson and Young, 2003).
The relationships among MUN; percentages of milk fat, milk protein, and lactose; and SCCt were analyzed by univariate GLM after categorizing them into 2 groups based on the presence or absence of bacterial infection in milk samples (Table 7). Most of the variables included in the model influenced MUN (P
<
0.001, R2 = 0.077). Regardless of the presence of bacterial infection in milk, the association between MUN and milk fat or protein was negative (P
<
0.001), whereas the associations between MUN and lactose (both in the presence and absence of bacteria) and SCCt (in the absence of bacteria) were not significant (P
>
0.05). Milk urea nitrogen was correlated with the month of the year (P
<
0.001), being positive in April (b = 0.6259) and May (b = 0.2195) and negative in the other months.
Table 7. The relationship between MUN and milk components categorized by presence or absence of bacteria and month of milk sampling on Korean dairy farms analyzed by univariate GLM
| Effect | Estimate | SE | P | |
|---|---|---|---|---|
| Intercept1 | 16.1958 | 1.2068 | 0.001 | |
| Intercept | [ISOLATE=0]2 | 2.993 | 1.2459 | 0.016 |
| [ISOLATE=1]3 | 0.0000 | |||
| Regression coefficient4 | [ISOLATE=0] | −0.3144 | 0.0176 | 0.001 |
| [ISOLATE=1] | −0.352 | 0.0506 | 0.001 | |
| [ISOLATE=0] | −0.8287 | 0.0567 | 0.001 | |
| [ISOLATE=1] | −0.5815 | 0.2124 | 0.006 | |
| [ISOLATE=0] | 0.0874 | 0.0558 | 0.117 | |
| [ISOLATE=1] | 0.262 | 0.1628 | 0.107 | |
| [ISOLATE=0] | 0.0049 | 0.0173 | 0.776 | |
| [ISOLATE=1] | 0.1769 | 0.0799 | 0.027 | |
| Month of sampling | ||||
| Intercept | January | −0.3661 | 0.0882 | 0.001 |
| February | −1.5389 | 0.0903 | 0.001 | |
| March | −0.5115 | 0.083 | 0.001 | |
| April | 0.6259 | 0.0827 | 0.001 | |
| May | 0.2195 | 0.0894 | 0.014 | |
| June | −0.8008 | 0.088 | 0.001 | |
| July | −0.97 | 0.0917 | 0.001 | |
| August | −0.229 | 0.0988 | 0.020 | |
| September | −1.7647 | 0.1006 | 0.001 | |
| October | −1.577 | 0.0868 | 0.001 | |
| November | −1.3548 | 0.094 | 0.001 | |
| December | 0.0000 |
1Means of the explained variable (MUN). |
2Raw milk samples of cattle with no bacterial infection. |
3Raw milk samples of cattle with bacterial infection. |
4Relationship of each milk component with the explained variable (MUN) was presented as a slope. |
5SCCt = natural logarithmic-transformed SCC. |
Relationships Between SCCt or MUN and Milk Components According to the Bacterial Species Isolated
Milk samples containing Staph. aureus, CNS spp., coagulase-positive staphylococci (CPS), Streptococcus spp., Enterococcus spp., E. coli, Pseudomonas spp., and yeast had higher SCCt and lower percentages of milk components and MUN than did milk samples without bacterial infection (P
<
0.001; Table 8). Average SCC of infected and uninfected milk samples were 1,180,000
±
1.75
cells/mL and 168,000
±
21.98
cells/mL, respectively. Milk samples of cows infected with contagious pathogens (Staph. aureus and CPS) had higher SCCt and lower percentages of milk fat and lactose than milk samples infected with environmental pathogens (Pseudomonas spp., E. coli, yeast, CNS spp., Enterococcus spp., and Streptococcus spp.) or those without bacterial infection (Table 8). In addition, each bacterial species differently influenced the SCCt of bovine raw milk (P
<
0.001; Table 9), in the order Staph. aureus, CPS, Pseudomonas spp., E. coli, yeast, CNS spp., Enterococcus spp., and Streptococcus spp.
Table 8. Means of milk components of the milk samples from Korean dairy farms grouped according to the presence of bacterial infection and the kinds of infected bacteria (environmental or contagious bacteria)
| Contamination status | Milk samples (n) | Frequency (%) | SCCt1 | Milk fat (%) | Milk protein (%) | Lactose (%) | MUN (mg/dL) | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SE | Mean | SE | Mean | SE | Mean | SE | Mean | SE | |||
| No bacteria | 27,638 | 92.1 | 4.5b | 0.01 | 3.79a | 0.01 | 3.21a | 0 | 4.85a | 0 | 15.18b | 0.02 |
| With bacteria | ||||||||||||
| 2,200 | 7.3 | 6.52a | 0 | 3.74b | 0.11 | 3.16b | 0.03 | 4.63b | 0.03 | 14.28ab | 0.32 | |
| 181 | 0.6 | 6.86a | 0.07 | 3.38c | 0.13 | 3.13b | 0.03 | 4.59b | 0.04 | 15.22a | 0.36 | |
| 2,381 | 7.9 | 6.77 | 0.02 | 3.63 | 0.03 | 3.15 | 0.01 | 4.64 | 0.01 | 14.77 | 0.07 | |
| Total | 30,019 | 100 | 4.68 | 0.01 | 3.78 | 0.01 | 3.2 | 0 | 4.83 | 0 | 15.2 | 0.02 |
a–cMeans within a column with different superscripts differ (one-way ANOVA, P |
1SCCt = natural logarithmic-transformed SCC. |
2Environmental bacteria = Pseudomonas spp., Escherichia coli, yeast, CNS, Enterococcus spp., Streptococcus spp. |
3Contagious bacteria = coagulase-positive staphylococci and Staphylococcus aureus. |
Table 9. The transformed SCC (SCCt) according to bovine infection with the different bacterial species analyzed by linear regression and bacterial isolation frequencies on Korean dairy farms
| Contamination status | Bacterial species | Bacterial isolates or milk samples (n) | Frequency (%) | Estimate1 | SE | P-value |
|---|---|---|---|---|---|---|
| Environmental bacteria | Streptococcus spp.2 | 49 | 2.1 | 0.83 | 0.07 | 0.001 |
| Enterococcus spp. | 46 | 1.9 | 1.04 | 0.07 | 0.001 | |
| CNS | 755 | 31.7 | 1.50 | 0.02 | 0.001 | |
| Yeast | 189 | 7.9 | 1.52 | 0.04 | 0.001 | |
| Escherichia coli | 705 | 29.6 | 1.56 | 0.02 | 0.001 | |
| Pseudomonas spp. | 456 | 19.2 | 1.59 | 0.02 | 0.001 | |
| Contagious bacteria | CPS3 | 77 | 3.2 | 1.59 | 0.06 | 0.001 |
| Staphylococcus aureus | 104 | 4.4 | 1.67 | 0.05 | 0.001 | |
| Total | 2,381 | 100.0 |
1Extent of the influence to transformed SCC (SCCt). |
2Streptococcus dysgalactiae and Streptococcus uberis. |
3Coagulase-positive staphylococci. |
Although the incidence of infection with contagious pathogens was much lower than that of infection with environmental pathogens, contagious pathogens had a greater effect on SCCt than did environmental pathogens (P
<
0.001). Bovine mastitis caused by Staph. aureus is very difficult to treat and can be transmitted easily to other cows in the herd (Moroni et al., 2006). Supporting earlier findings (Moroni et al., 2006), we found that CNS spp. were the most commonly identified bacteria (32%) in milk samples that were bacteriologically positive. Approximately 70 to 80% of E. coli infections had clinical outcomes (abnormal milk, udder swelling, or systemic symptoms; Harmon, 1994). We isolated E. coli (30%) and Pseudomonas spp. (19%) in milk samples with bacterial infection. These pathogens can cause chronic infections that respond inadequately to antimicrobial therapy (Erskine et al., 2002). The influence of these organisms on SCCt was followed by Staph. aureus (Table 9). Our results indicate that controlling Staph. aureus is critical for reducing SCCt in milk, and careful control of CNS spp., E. coli, and Pseudomonas spp. in raw milk in Korea is required to reduce or prevent mastitis.
Conclusions
We statistically analyzed the relationship between SCCt or MUN and milk components. The SCCt was negatively associated with the percentages of milk fat and lactose, and MUN was negatively associated with the percentages of milk fat and protein; however, we observed a positive relationship between SCCt and milk protein percentage by using a linear regression model. In infected milk samples, there were negative relationships between SCCt and the percentages of milk fat, milk protein, and lactose. The bacterial species was an important factor influencing SCC, with Staph. aureus being the most responsible for the increase in SCC, and the high incidence of CNS, E. coli, and Pseudomonas spp. could not be disregarded. Because there is no simple solution for controlling bovine mastitis (its prevention and early detection) by maintaining good milking hygiene, low SCC and optimal MUN may be an effective way not only of controlling this disease, but also of improving milk quality.
Acknowledgments
This work was supported by a grant from the Agribrands Purina Korea Inc., Sungnam, Gyeonggi, Republic of Korea. Additional support was provided by the Korean Research Foundation Grant (KRF-2006-005-J02903, KRF-2007-331-E00254), Research Institute of Veterinary Science, College of Veterinary Medicine, BK21 Program for Veterinary Science, Seoul National University.
Supplementary data
Interpretive summary.
References
- . Bovine mastitis: An evolving disease. Vet. J. 2002;164:116–128
- . Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992;30:1654–1660
- . A statistical evaluation of animal and nutritional factors influencing concentrations of milk urea nitrogen. J. Dairy Sci. 1997;80:2964–2970
- . Factors affecting milk urea nitrogen and protein concentrations in Quebec dairy cows. Prev. Vet. Med. 1999;39:53–63
- . Modulation of function of bovine polymorphonuclear leukocytes and lymphocytes by high temperature in vitro and in vivo. Am. J. Vet. Res. 1991;52:1692–1698
- . Trends in antibacterial susceptibility of mastitis pathogens during a seven-year period. J. Dairy Sci. 2002;85:1111–1118
- . Identification of staphylococcal and streptococcal causes of bovine mastitis using 16S–23S rRNA spacer regions. Microbiology. 1997;143:3491–3500
- . Factors associated with milk urea concentrations in Ontario dairy cows. J. Dairy Sci. 2001;84:107–114
- . Physical of mastitis and factors affecting somatic cell counts. J. Dairy Sci. 1994;7:2103–2112
- . Relationships between milk urea and production, nutrition, and fertility traits in Israeli dairy herds. J. Dairy Sci. 2004;87:1001–1011
- . The association between milk urea nitrogen and DHI Production variables in western commercial dairy herds. J. Dairy Sci. 2003;86:3008–3015
- . Milk urea nitrogen target concentrations for lactating dairy cows fed according to National Research Council recommendations. J. Dairy Sci. 1999;82:1261–1273
- . Dairy herd management practices that impact nitrogen utilization efficiency. J. Dairy Sci. 2002;85:1218–1226
- . Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. 1999;37:3497–3503
- Korea Dairy Committee. 2007. Unpublished data. http://www.dairy.or.kr/ Accessed June 2007.
- . Changes in milk composition as affected by subclinical mastitis in goats. J. Dairy Sci. 2004;87:1719–1726
- . Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J. Clin. Microbiol. 1998;36:618–623
- . Interpretation of protein-energy balance of feeding by milk urea nitrogen and milk protein content in lactation Holstein cow. Kor. J. Anim. Sci. Technol. 2000;42:499–510
- . Relationships between somatic cell count and intramammary infections in buffaloes. J. Dairy Sci. 2006;89:998–1003
- . Proteolysis in milk during experimental Escherichia coli mastitis. J. Dairy Sci. 2004;87:2923–2931
- . Influence of somatic cell count and storage interval on composition and processing characteristics of milk from cows in late lactation. Aust. J. Dairy Technol. 2001;56:213–218
- . Mastitis. Clinical Veterinary Microbiology. London, UK.: Wolfe Publishing; 1994;Page 327
- . Ontario bulk milk somatic cell count reduction program: Progress and outlook. J. Dairy Sci. 1998;81:1545–1554
- . Changes in milk protein fraction as affected by subclinical mastitis. J. Dairy Sci. 1999;82:2402–2411
- . Characterization and identification of streptococci isolated from bovine mammary glands. J. Dairy Sci. 1988;71:1616–1624
- . Genetic parameters for yield traits of Holsteins, including lactose and somatic cell scores. J. Dairy Sci. 1992;75:1342–1348
PII: S0022-0302(07)72013-1
doi:10.3168/jds.2007-0282
© 2007 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

