Advertisement
Research Article| Volume 98, ISSUE 3, P1426-1434, March 2015

Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC

  • Y. Gezginc
    Affiliations
    Faculty of Agriculture, Department of Food Engineering, Kahramanmaraş Sutcu İmam University, 46060/Avsar, Kahramanmaras, Turkey
    Search for articles by this author
  • F. Topcal
    Affiliations
    Research and Development Center for University-Industry Public Relations (USKIM), Microbiology and Microbial Genetics Laboratory, and Kahramanmaraş Sutcu İmam University, 46060/Avsar, Kahramanmaras, Turkey
    Search for articles by this author
  • S. Comertpay
    Correspondence
    Corresponding author:
    Affiliations
    Faculty of Agriculture, Department of Agricultural Biotechnology, Kahramanmaraş Sutcu İmam University, 46060/Avsar, Kahramanmaras, Turkey
    Search for articles by this author
  • I. Akyol
    Affiliations
    Research and Development Center for University-Industry Public Relations (USKIM), Microbiology and Microbial Genetics Laboratory, and Kahramanmaraş Sutcu İmam University, 46060/Avsar, Kahramanmaras, Turkey

    Faculty of Agriculture, Department of Agricultural Biotechnology, Kahramanmaraş Sutcu İmam University, 46060/Avsar, Kahramanmaras, Turkey
    Search for articles by this author
Open ArchivePublished:December 26, 2014DOI:https://doi.org/10.3168/jds.2014-8447
Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC
Previous ArticleFatty acid profile differs between organic and conventionally produced cow milk independent of season or milking time
Next ArticleAnalysis method for determination of nisin A and nisin Z in cow milk by using liquid chromatography-tandem mass spectrometry

      Abstract

      The present study was conducted to evaluate the lactic acid– and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic–anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the wild lactic acid bacteria strains, holds the potential for the selection of the most desirable strains to be used as starters in commercial yogurt manufacture in the future.

      Key words

      Introduction

      Lactic acid bacterial species (LAB) are an industrially important group of bacteria and are used for the production of fermented foods, such as cheese, butter, and yogurt. When LAB ferment milk sugar (lactose), they produce lactic acid and some volatile compounds, which ultimately generate yogurt with its characteristic texture and taste. Yogurt is one of the most popular fermented milk products around the world (
      • Magenis R.B.
      • Prudencio E.S.
      • Amboni R.D.M.C.
      • Junior N.G.C.
      • Oliveira R.V.B.
      • Soldi V.
      • Benedet H.D.
      Compositional and physical properties of yogurts manufactured from milk and whey cheese concentrated by ultrafiltration.
      Int. J. Food Sci. Technol. 2006; 41: 560-568
      ) for its flavor, health benefits, and therapeutic values. It is an excellent source of calcium, and it provides proteins containing all amino acids that are essential to human health. Besides, the vitamins and minerals found in yogurt are bioavailable, thus they can be readily absorbed and used by the body. In addition to the above-mentioned nutritional values, yogurt can contribute to gastrointestinal health and is beneficial for certain conditions including lactose intolerance, diarrheal diseases, and colon cancer (
      • Adolfsson O.
      • Meydani S.N.
      • Russell R.M.
      Yogurt and gut function.
      Am. J. Clin. Nutr. 2004; 80: 245-256
      ).
      The most common LAB species that are used as starter cultures in industrial yogurt production are Streptococcus thermophilus and Lactobacillus bulgaricus (
      • Ginovart M.
      • Lopez D.
      • Valls J.
      • Silbert M.
      Simulation modelling of bacterial growth in yogurt.
      Int. J. Food Microbiol. 2002; 73: 415-425
      ). When coexisted in the starter, the 2 strains synergistically alter the physicochemical properties and the combination of aroma compounds in yogurt as compared with the products made using each single strain separately (
      • Georgala A.
      • Tsakalidou K.
      • Kandarakis E.
      • Kalantzopoulos G.
      Flavour production in ewe’s milk and ewe’s milk yogurt, by single strains and combinations of Streptococcus thermophilus and Lactobacillus delbrueckii subsp bulgaricus, isolated from traditional Greek yogurt.
      Lait. 1995; 75: 271-283
      ). Although both species are able to produce lactic acid, a variety of aromatic compounds, and organic acids, which altogether constitute the typical flavor and the texture of yogurt, their productivities differ considerably (
      • Cheng H.F.
      Volatile flavor compounds in yogurt: A review.
      Crit. Rev. Food Sci. Nutr. 2010; 50: 938-950
      ). Therefore, the levels of the molecules found in the final product change depending on the type and the percentage of the LAB strains present in a starter culture.
      As an imperative source of flavor and functionality in numerous fermented food products, lactic acid is also responsible for the refreshing tart flavor of yogurt (
      • Panagiotidis P.
      • Tzia C.
      Effect of milk composition and heating on flavor and aroma of yogurt.
      Food Flavors and Chemistry: Advances of the New Millennium. Royal Soc. Chem., Cambridge, UK2001: 160-167
      ). It is a well-studied metabolite generated from lactose by a chain of enzymatic reactions that occur during fermentation and is a crucial component of yogurt production because it helps the formation of the yogurt gel by reducing the pH and solubilizing micellar calcium phosphate (
      • Zhang Q.L.
      • Ren J.Y.
      • Zhao H.F.
      • Zhao M.M.
      • Xu J.Y.
      • Zhao Q.Z.
      Influence of casein hydrolysates on the growth and lactic acid production of Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus.
      Int. J. Food Sci. Technol. 2011; 46: 1014-1020
      ). Its content in yogurt is usually around 0.9%, and it provides the product with a sharp and acidic taste (
      • Cheng H.F.
      Volatile flavor compounds in yogurt: A review.
      Crit. Rev. Food Sci. Nutr. 2010; 50: 938-950
      ).
      Lactic acid has 2 stereoisomers, d(−) and l(+), that may be produced via reduction of pyruvate by various lactate dehydrogenases (LDH) grouped as d-LDH and l-LDH depending on the isomer they lead to form. The gene encoding the l-LDH enzyme in Strep. thermophilus was cloned and found to carry at least 60% similarity with other LAB species, such as Streptococcus mutans, Lactococcus lactis, Lactobacillus casei, and Lactobacillus plantarum, and to contain a promoter-like sequence akin to the Escherichia coli promoter consensus (
      • Ito Y.
      • Sasaki T.
      Cloning and nucleotide sequencing of l-lactate dehydrogenase gene from Streptococcus thermophilus M-192.
      Biosci. Biotechnol. Biochem. 1994; 58: 1569-1573
      ). The enzyme was also determined to be coded by the 987-bp-long ldh gene in 2 strains of Strep. thermophilus, CNRZ1066 and LMG18311 (
      • Bolotin A.
      • Quinquis B.
      • Renault P.
      • Sorokin A.
      • Ehrlich S.D.
      • Kulakauskas S.
      • Lapidus A.
      • Goltsman E.
      • Mazur M.
      • Pusch G.D.
      • Fonstein M.
      • Overbeek R.
      • Kyprides N.
      • Purnelle B.
      • Prozzi D.
      • Ngui K.
      • Masuy D.
      • Hancy F.
      • Burteau S.
      • Boutry M.
      • Delcour J.
      • Goffeau A.
      • Hols P.
      Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus.
      Nat. Biotechnol. 2004; 22: 1554-1558
      ). In L. bulgaricus strain 2308, on the other hand, 5 genes were identified to encode LDH, with 3 (ldhD1, LBU0066; ldhD2, LBU0860; ldhD3, LBU1637) encrypting d-LDH, whereas 2 (ldhL1, LBU0059; ldhL2, LBU0084) were used in l-LDH production, despite to their unequal expression levels (
      • Hao P.
      • Zheng H.
      • Yu Y.
      • Ding G.
      • Gu W.
      • Chen S.
      • Yu Z.
      • Ren S.
      • Oda M.
      • Konno T.
      • Wang S.
      • Li X.
      • Ji Z.S.
      • Zhao G.
      Complete sequencing and pan-genomic analysis of Lactobacillus delbrueckii ssp. bulgaricus reveal its genetic basis for industrial yogurt production.
      PLoS ONE. 2011; 6: e15964
      ). Additionally, it was found that L. bulgaricus strain ND02 had an ldh gene that occupies a 924-bp-long space in its 2,125,753-bp circular DNA (
      • Sun Z.
      • Chen X.
      • Wang J.
      • Zhao W.
      • Shao Y.
      • Guo Z.
      • Zhang X.
      • Zhou Z.
      • Sun T.
      • Wang L.
      • Meng H.
      • Zhang H.
      • Chen W.
      Complete genome sequence of Lactobacillus delbrueckii ssp. bulgaricus strain ND02.
      J. Bacteriol. 2011; 193: 3426-3427
      ).
      Along with lactic acid, acetaldehyde, diacetyl acetoin, acetone, and 2-butanone substantially redound to the typical aroma of yogurt. The characteristic aroma of the product is defined by the amount of acetaldehyde found in it, and acetaldehyde concentration in the range of 23 to 40 mg/kg is required to consider yogurt as having good flavor (
      • Cheng H.F.
      Volatile flavor compounds in yogurt: A review.
      Crit. Rev. Food Sci. Nutr. 2010; 50: 938-950
      ).
      During yogurt fermentation, acetaldehyde can be produced through pyruvate decarboxylation or amino acid conversion. As for amino acid conversion, threonine can be directly transformed into acetaldehyde by the enzymatic activity of threonine aldolase. In Strep. thermophilus, the only enzyme with threonine aldolase activity is glyA enzyme, also known as serine hydroxymethyl transferase (SHMT, EC 2.1.2.1.) This enzyme is encoded by the glyA gene in the species, and its overexpression has been reported to significantly increase acetaldehyde formation, whereas threonine aldolase activity is completely obstructed when it is disrupted (
      • Chaves A.C.S.D.
      • Fernandez M.
      • Lerayer A.L.S.
      • Mierau I.
      • Kleerebezem M.
      • Hugenholtz J.
      Metabolic engineering of acetaldehyde production by Streptococcus thermophilus.
      Appl. Environ. Microbiol. 2002; 68: 5656-5662
      ). An identical gene for the enzyme has been detected in 3 strains of Strep. thermophilus: CNRZ1066, LMG18311, and JIM8232 (
      • Bolotin A.
      • Quinquis B.
      • Renault P.
      • Sorokin A.
      • Ehrlich S.D.
      • Kulakauskas S.
      • Lapidus A.
      • Goltsman E.
      • Mazur M.
      • Pusch G.D.
      • Fonstein M.
      • Overbeek R.
      • Kyprides N.
      • Purnelle B.
      • Prozzi D.
      • Ngui K.
      • Masuy D.
      • Hancy F.
      • Burteau S.
      • Boutry M.
      • Delcour J.
      • Goffeau A.
      • Hols P.
      Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus.
      Nat. Biotechnol. 2004; 22: 1554-1558
      ;
      • Delorme C.
      • Bartholini C.
      • Luraschi M.
      • Pons N.
      • Loux V.
      • Almeida M.
      • Guédon E.
      • Gibrat J.F.
      • Renault P.
      Complete genome sequence of the pigmented Streptococcus thermophilus strain JIM8232.
      J. Bacteriol. 2011; 193: 5581-5582
      ). In L. bulgaricus, however, no such gene has yet been identified (
      • Sun Z.
      • Chen X.
      • Wang J.
      • Zhao W.
      • Shao Y.
      • Guo Z.
      • Zhang X.
      • Zhou Z.
      • Sun T.
      • Wang L.
      • Meng H.
      • Zhang H.
      • Chen W.
      Complete genome sequence of Lactobacillus delbrueckii ssp. bulgaricus strain ND02.
      J. Bacteriol. 2011; 193: 3426-3427
      ).
      It was previously shown that the strains in starter cultures could produce distinctly different flavors depending on their origins, and that some wild strains might be functional to produce dairy products with special traits (
      • Ayad E.H.E.
      • Verheul A.
      • de Jong C.
      • Wouters J.T.M.
      • Smit G.
      Flavour forming abilities and amino acid requirements of Lactococcus lactis strains isolated from artisanal and non-dairy origin.
      Int. Dairy J. 1999; 9: 725-735
      ). Besides, it has also been demonstrated that the flavor-forming abilities of LAB differ not only among species but also within the strains of the same species (
      • Pastink M.I.
      • Sieuwertsa S.
      • de Bok F.A.M.
      • Janssen P.W.M.
      • Teusink B.
      • van Hylckama Vlieg J.E.T.
      • Hugenholtza J.
      Genomics and high-throughput screening approaches for optimal flavour production in dairy fermentation.
      Int. Dairy J. 2008; 18: 781-789
      ). Therefore, to obtain a product with the qualities in demand, it is critical to recognize the metabolite formation abilities of strains to be used as starters.
      Industrial strains of LAB are commercially available, whereas wild strains of LAB can be obtained from assorted sources, ranging from milk environments to plants, animals, and soil (
      • Ayad E.H.E.
      • Verheul A.
      • Wouters J.T.M.
      • Smit G.
      Application of wild starter cultures for flavour development in pilot plant cheese making.
      Int. Dairy J. 2000; 10: 169-179
      ). In Turkey, where industrial yogurt production has recently reached more than 1 million tonnes in a year, traditional yogurt has been manufactured in individual households for centuries (
      • Kabak B.
      • Dobson A.D.W.
      An introduction to the traditional fermented foods and beverages of Turkey.
      Crit. Rev. Food Sci. Nutr. 2011; 51: 248-260
      ). Nevertheless, the properties of the LAB strains isolated from traditional Turkish yogurts have been poorly studied. The present work focuses on analyzing the lactic acid- and acetaldehyde-formation abilities of Strep. thermophilus and L. bulgaricus strains isolated from traditional Turkish yogurts made in various regions of the country so as to evaluate their potentials to be used as a starter in yogurt industry.

      Materials and Methods

      Isolation of Bacterial Strains

      A total of 126 strains of Strep. thermophilus and L. bulgaricus were assayed for lactic acid and acetaldehyde production. To isolate the strains from homemade traditional yogurts produced in different parts of Turkey, a modified version of the method described by
      • Kao Y.T.
      • Liu Y.S.
      • Shyu Y.T.
      Identification of Lactobacillus spp. in probiotic products by real-time PCR and melting curve analysis.
      Food Res. Int. 2007; 40: 71-79
      was used. In short, the samples were aseptically weighted, homogenized, and centrifuged at 850 × g at 4°C for 3 min. The supernatant was transferred to a clean tube and recentrifuged at 17,000 × g at 4°Cfor 30 s. The supernatant was again transferred and centrifuged at 17,000 × g at 4°C for 15 min. The pellet was diluted as 1:10 by using peptone water (Sigma-Aldrich , St. Louis, MO). Followed by making a 10-fold serial dilution, 0.1 mL of each sample was subcultured in triplicate. The samples were inoculated in Petri dishes with de Man, Rogosa, and Sharpe (MRS) agar for L. bulgaricus and SM17 agar for Strep. thermophilus, and the dishes were incubated at 37 and 42°C, respectively.

      Identification of Strains

      Morphological and Biochemical Identification

      Despite the fact that each bacteria species was expected to grow in their best-suited media predominantly, cell morphology, Gram staining, and catalase-activity properties of the strains were analyzed to approve their identities. After the standard Gram staining method was performed, catalase activity was measured by dropping 20 μL of 3% H2O2 (Sigma-Aldrich) on gram-positive cells and observing whether any bubble formation has occurred or not. Only the morphologically suitable and gram-positive colonies with no catalase activity were further analyzed.

      Molecular Identification

      Grown single colonies were checked by species-specific PCR and used the length of the PCR products to verify the species as previously described (
      • Tabasco R.
      • Paarup T.
      • Janer C.
      • Pelaez C.
      • Requena T.
      Selective enumeration and identification of mixed cultures of Streptococcus thermophilusLactobacillus delbrueckii subsp bulgaricusL. acidophilusL. paracasei subsp paracasei and Bifidobacterium lactis in fermented milk.
      Int. Dairy J. 2007; 17: 1107-1114
      ). Primers within variable regions in the 16S rRNA encoding genes of Strep. thermophilus and L. bulgaricus (StF: 5′ ACGCTGAAGAGAGGAGCTTG 3′, StR: 5′ GCAATTGCCCCTTTCAAATA 3′ and LbF: 5′ TCAAAGATTCCTTCGGGATG 3′, LbR: 5′ TACGCATCATTGCCTTGGTA 3′) were purchased from Inontek (Istanbul, Turkey). Polymerase chain reaction was performed in 40 μL by using 5 U/μL DNA polymerase (Thermo Scientific, Waltham, MA) and 10× PCR buffer (Thermo Scientific). A total of 20 pmol of each primer was used, and deoxynucleoside triphosphate (Thermo Scientific) was used at a concentration of 250 μM each. The amplification condition was as follows: predenaturation at 95°C for 5 min, 30 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 20 s, and a final extension at 72°C for 5 min. The products (5 μL plus 1 μL of 6× loading dye) were run on a 2% agarose gel. Amplicons with 157 bp verified Strep. thermophilus identity, whereas L. bulgaricus was defined with 232-bp PCR band. After molecular identification was completed, the identities of the colonies were confirmed by their visualization under electron microscope.

      Growth Conditions

      Once their identities were verified, Strep. thermophilus strains (n = 91) were grown in cow milk or in SM17 prepared by adding 1% (wt/vol) sucrose to M17 medium (
      • Terzaghi B.E.
      • Sandine W.E.
      Improved medium for lactic streptococci and their bacteriophages.
      Appl. Microbiol. 1975; 29: 807-813
      ) at 42°C under aerobic and anaerobic conditions. Lactobacillus bulgaricus strains (n = 35), on the other hand, were grown in cow milk or in MRS medium (
      • De Man J.C.
      • Rogosa M.
      • Sharpe M.E.
      A medium for the cultivation of lactobacilli.
      J. Appl. Bacteriol. 1960; 23: 130-135
      ) at 37°C under aerobic and anaerobic conditions. Anaerobic conditions were obtained as previously described (
      • Akyol I.
      • Serdaroglu K.
      • Gezginc Y.
      • Dayisoylu K.S.
      • Ekinci M.S.
      • Ozkose E.
      Redirection of pyruvate pathway of lactic acid bacteria to improve cheese quality.
      Food Biotechnol. 2009; 23: 200-213
      ).

      Metabolic-End-Products Analysis by HPLC

      The amounts of lactic acid and acetaldehyde present in the growth media where each isolate carried fermentation were analyzed using HPLC [Research and Development Center for University-Industry-Public Relations (USKIM) Kahramanmaras Sutcu Imam University, Turkey] as described by
      • Akyol I.
      • Serdaroglu K.
      • Gezginc Y.
      • Dayisoylu K.S.
      • Ekinci M.S.
      • Ozkose E.
      Redirection of pyruvate pathway of lactic acid bacteria to improve cheese quality.
      Food Biotechnol. 2009; 23: 200-213
      . Briefly, 1 mL of overnight cultured medium was centrifuged at 14,000 × g at 4°C for 5 min. The supernatant was filtered and placed in a fresh Eppendorf tube. The sample was diluted 1-fold in 0.5% meta-phosphoric acid (Sigma-Aldrich), and 20 μL of the solution was injected onto the HPLC. Separation was performed on a 150 × 4.6-mm Capcell Pak 5 μM C18 MG column (Shiseido Co. Ltd., Tokyo, Japan) by using continuous gradient elution with phosphate buffer solution (mobile phase A; Sigma-Aldrich) and acetonitrile (mobile phase B; Sigma-Aldrich) at 30°C. The total separation time was 5 min, and the gradient was run for 6 min to ensure full separation. Besides, the extension of the HPLC column from 250 to 400 mm has provided us with a technique that can be used to separate acetaldehyde and l-lactic acid in a single run.
      Calibration graphs for absorbances against changing concentrations of the metabolites were drawn to calculate acetaldehyde and lactic acid amounts in samples. l-lactic acid, which absorbs the light at 277 nm, was used as the standard for lactic acid; consequently, lactic acid concentrations were represented chiefly by the l-lactic acid produced. Acetaldehyde levels, on the other hand, were detected by the absorbance of the light at 210 nm.

      Statistical Analysis

      The ANOVA and differences between means were tested by one-way ANOVA using SPSS software (SPSS Inc., Chicago, IL). The results were considered to be statistically significant when the P-value was ≤ 0.001.

      Results

      Isolation and Identification

      A total of 91 strains were identified as Strep. thermophilus thanks to the species-specific PCR that produced 157-bp band, whereas 36 strains were found to belong to L. bulgaricus species generating 232-bp PCR band (data not shown). Under electron microscope, shapes of the strains verified the molecular findings (data not shown).

      Metabolite Production by Strep. thermophilus Isolates

      The HPLC analyses for Strep. thermophilus strains (shown in Table 1) revealed that in anaerobic SM17, the highest amount of acetaldehyde was produced by BioSt169 (69.65 ± 2.2 mg/kg), whereas the lowest was measured for BioSt22 (0.0 ± 0.0 mg/kg). In aerobic SM17, however, BioSt164 was the most productive isolate (99.6 ± 0.6 mg/kg), whereas BioSt36 was the least productive (0.1 ± 0.0 mg/kg). When the isolates were grown in LM17, BioSt164 and BioSt47 generated the highest (105.9 ± 8.4 mg/kg) and the lowest (0.9 ± 0.0 mg/kg) amount of acetaldehyde, respectively. As for in milk, the most productive isolate was BioSt47 (21.1 ± 0.1 mg/kg) and the least productive strain was BioSt109 (0.0 ± 0.0 mg/kg).
      Table 1Amounts (means ± SD) of metabolites acetaldehyde and lactic acid produced by 91 strains of Streptococcus thermophilus under various culture conditions
      StrainAcetaldehyde (mg/kg)Lactic acid (mg/kg)
      SM17 agarLM17 agarMilkSM17 agarLM17 agarMilk
      AnaerobicAerobicAnaerobicAerobic
      BioSt141.0 ± 1.141.0 ± 5.265.2 ± 1.01.3 ± 0.122.2 ± 1.016.7 ± 1.412.6 ± 0.20.4 ± 0.0
      BioSt30.1 ± 0.01.1 ± 0.123.8 ± 1.0ND
      ND=not detectable.
      		5.2 ± 0.38.1 ± 0.437.7 ± 2.30.6 ± 0.0
      BioSt40.1 ± 0.00.1 ± 0.028.8 ± 0.30.1 ± 0.03.6 ± 0.27.5 ± 0.833.1 ± 0.60.7 ± 0.0
      BioSt70.1 ± 0.01.0 ± 0.125.5 ± 1.20.3 ± 0.17.8 ± 0.14.5 ± 0.721.8 ± 2.27.1 ± 0.0
      BioSt840.5 ± 5.216.1 ± 2.635.4 ± 3.70.1 ± 0.02.1 ± 0.211.1 ± 1.914.0 ± 0.72.2 ± 1.0
      BioSt90.0 ± 0.06.8 ± 1.07.1 ± 0.5ND2.1 ± 0.111.1 ± 3.914.0 ± 3.63.3 ± 1.0
      BioSt1040.5 ± 3.216.1 ± 2.635.4 ± 1.60.1 ± 0.00.6 ± 0.08.7 ± 1.218.5 ± 1.41.4 ± 0.5
      BioSt12ND1.2 ± 0.036.0 ± 3.20.4 ± 0.04.8 ± 0.619.4 ± 1.520.7 ± 2.61.2 ± 0.1
      BioSt130.5 ± 0.16.4 ± 1.27.5 ± 1.50.0 ± 0.016.4 ± 2.218.7 ± 2.314.4 ± 2.23.1 ± 0.5
      BioSt145.2 ± 0.233.5 ± 3.25.6 ± 0.20.3 ± 0.04.8 ± 0.619.4 ± 0.425.1 ± 3.51.6 ± 0.2
      BioSt151.2 ± 0.24.9 ± 2.44.5 ± 3.50.2 ± 0.118.4 ± 2.616.2 ± 3.312.7 ± 1.63.7 ± 0.9
      BioSt160.4 ± 0.06.4 ± 0.85.6 ± 0.20.1 ± 0.019.9 ± 3.120.0 ± 1.415.6 ± 1.02.7 ± 0.4
      BioSt170.2 ± 0.05.5 ± 0.64.1 ± 0.20.5 ± 0.018.1 ± 1.624.5 ± 2.817.5 ± 1.42.3 ± 0.0
      BioSt180.4 ± 0.05.5 ± 0.34.5 ± 0.00.3 ± 0.118.3 ± 0.518.2 ± 0.54.1 ± 0.02.7 ± 0.2
      BioSt190.2 ± 0.05.4 ± 0.13.9 ± 0.10.3 ± 0.018.0 ± 1.119.8 ± 1.013.7 ± 0.64.2 ± 0.4
      BioSt200.3 ± 0.04.8 ± 0.55.3 ± 0.40.2 ± 0.016.5 ± 0.319.8 ± 0.111.8 ± 0.91.1 ± 0.1
      BioSt220.0 ± 0.05.3 ± 0.63.0 ± 0.10.1 ± 0.018.5 ± 2.321.2 ± 3.76.3 ± 0.50.1 ± 0.0
      BioSt230.9 ± 0.11.9 ± 0.14.9 ± 0.10.3 ± 0.053.3 ± 0.537.3 ± 0.412.8 ± 0.13.4 ± 0.1
      BioSt240.2 ± 0.04.5 ± 0.24.2 ± 0.60.1 ± 0.019.7 ± 0.132.0 ± 0.924.7 ± 1.73.6 ± 0.5
      BioSt250.4 ± 0.03.5 ± 0.44.8 ± 0.10.2 ± 0.018.7 ± 1.629.0 ± 3.326.6 ± 2.33.4 ± 0.2
      BioSt260.5 ± 0.01.2 ± 0.1ND0.2 ± 0.033.8 ± 2.355.6 ± 4.321.7 ± 1.11.0 ± 0.0
      BioSt276.4 ± 0.015.3 ± 0.923.1 ± 1.10.2 ± 0.14.4 ± 0.336.2 ± 0.522.8 ± 1.31.0 ± 0.2
      BioSt288.7 ± 0.610.1 ± 1.349.7 ± 5.10.4 ± 0.14.3 ± 0.630.4 ± 2.021.9 ± 5.11.6 ± 0.1
      BioSt290.2 ± 0.015.9 ± 1.319.4 ± 1.91.0 ± 0.222.1 ± 2.027.6 ± 2.223.8 ± 8.80.1 ± 0.0
      BioSt300.8 ± 0.06.8 ± 0.727.5 ± 2.10.6 ± 0.021.1 ± 2.129.4 ± 2.416.1 ± 1.20.0 ± 0.0
      BioSt330.3 ± 0.06.2 ± 0.420.0 ± 1.00.5 ± 0.017.8 ± 0.521.4 ± 2.120.5 ± 1.60.0 ± 0.0
      BioSt3415.6 ± 0.93.7 ± 0.439.6 ± 5.01.1 ± 0.021.0 ± 1.626.7 ± 0.714.3 ± 0.90.0 ± 0.0
      BioSt350.8 ± 0.05.3 ± 0.115.9 ± 0.90.3 ± 0.019.8 ± 1.827.6 ± 2.619.0 ± 1.36.4 ± 0.4
      BioSt360.0 ± 0.00.1 ± 0.016.7 ± 1.50.3 ± 0.017.8 ± 1.032.5 ± 1.310.5 ± 1.03.6 ± 0.2
      BioSt3729.2 ± 2.321.6 ± 1.829.9 ± 2.10.4 ± 0.016.2 ± 1.616.2 ± 1.519.1 ± 1.84.0 ± 0.3
      BioSt380.7 ± 0.0710.3 ± 1.122.5 ± 1.60.7 ± 0.01.7 ± 0.11.7 ± 0.111.1 ± 1.01.7 ± 0.0
      BioSt401.0 ± 0.03.4 ± 0.18.5 ± 0.40.2 ± 0.023.2 ± 2.027.9 ± 2.515.2 ± 1.328.3 ± 2.1
      BioSt424.1 ± 0.35.9 ± 0.316.1 ± 1.41.8 ± 1.034.5 ± 0.739.8 ± 2.839.9 ± 3.10.6 ± 0.0
      BioSt430.4 ± 0.05.5 ± 0.73.5 ± 0.32.5 ± 2.043.3 ± 4.134.8 ± 3.336.0 ± 1.132.5 ± 1.7
      BioSt4443.9 ± 2.512.3 ± 0.951.1 ± 1.60.2 ± 0.08.7 ± 0.512.0 ± 0.24.6 ± 0.30.4 ± 0.0
      BioSt450.0 ± 0.09.3 ± 0.420.0 ± 1.60.2 ± 0.08.6 ± 0.612.0 ± 1.120.2 ± 0.90.9 ± 0.1
      BioSt4610.0 ± 1.06.3 ± 0.414.3 ± 1.30.3 ± 0.024.7 ± 1.923.7 ± 1.223.7 ± 2.20.5 ± 0.0
      BioSt4742.3 ± 0.01.6 ± 0.00.9 ± 0.021.1 ± 0.123.8 ± 2.121.4 ± 2.122.4 ± 1.416.7 ± 1.1
      BioSt4917.4 ± 1.30.2 ± 0.027.0 ± 1.00.2 ± 0.019.6 ± 1.622.1 ± 2.126.9 ± 2.115.1 ± 1.0
      BioSt5027.5 ± 2.30.1 ± 0.030.2 ± 2.90.1 ± 0.03.6 ± 0.312.5 ± 1.18.6 ± 0.40.4 ± 0.0
      BioSt5329.9 ± 1.310.2 ± 0.626.0 ± 1.07.1 ± 0.420.3 ± 2.128.8 ± 2.611.9 ± 1.113.01 ± 1.2
      BioSt5432.7 ± 2.39.4 ± 0.331.1 ± 1.38.0 ± 0.622.2 ± 2.017.8 ± 1.525.0 ± 2.313.6 ± 0.8
      BioSt550.3 ± 0.04.5 ± 0.138.4 ± 2.3ND57.7 ± 0.019.7 ± 1.219.5 ± 1.3ND
      BioSt5618.3 ± 1.83.2 ± 0.121.0 ± 1.90.3 ± 0.022.0 ± 1.122.1 ± 2.030.8 ± 1.314.2 ± 0.5
      BioSt5723.0 ± 1.83.0 ± 0.517.6 ± 0.80.3 ± 0.037.9 ± 2.822.7 ± 2.127.9 ± 2.711.4 ± 1.1
      BioSt5827.2 ± 1.82.5 ± 1.816.9 ± 1.10.2 ± 0.03.7 ± 0.220.3 ± 1.127.1 ± 1.59.0 ± 0.4
      BioSt5921.4 ± 1.01.7 ± 0.16.2 ± 0.60.2 ± 0.020.1 ± 0.619.4 ± 1.632.0 ± 1.78.0 ± 0.7
      BioSt6017.2 ± 1.18.5 ± 0.62.8 ± 0.10.2 ± 0.019.8 ± 1.120.8 ± 1.815.4 ± 0.89.2 ± 0.7
      BioSt6120.4 ± 1.98.2 ± 0.84.2 ± 0.40.1 ± 0.020.1 ± 2.029.1 ± 2.317.4 ± 0.28.1 ± 0.8
      BioSt6221.1 ± 1.914.3 ± 0.73.0 ± 0.20.5 ± 0.04.3 ± 0.212.1 ± 0.1ND0.5 ± 0.0
      BioSt630.5 ± 0.1ND10.2 ± 0.4ND21.0 ± 2.127.6 ± 2.450.3 ± 0.114.0 ± 1.3
      BioSt640.5 ± 0.0ND10.2 ± 0.3ND55.1 ± 0.160.3 ± 0.150.3 ± 0.126.9 ± 0.1
      BioSt660.3 ± 0.10.9 ± 0.16.4 ± 0.12.0 ± 1.821.8 ± 0.429.0 ± 0.115.4 ± 0.111.6 ± 0.1
      BioSt676.0 ± 0.12.0 ± 0.110.3 ± 0.51.7 ± 0.10.2 ± 0.011.9 ± 1.024.7 ± 2.40.3 ± 0.0
      BioSt688.4 ± 0.322.7 ± 1.914.6 ± 13.20.1 ± 0.013.4 ± 0.411.3 ± 0.124.6 ± 0.70.2 ± 0.0
      BioSt690.3 ± 0.01.7 ± 0.129.8 ± 1.31.9 ± 0.1ND11.4 ± 0.829.0 ± 1.30.3 ± 0.0
      BioSt700.2 ± 0.02.1 ± 0.25.3 ± 0.51.6 ± 0.1ND10.6 ± 1.027.5 ± 2.20.2 ± 0.0
      BioSt710.2 ± 0.02.0 ± 0.27.3 ± 0.60.8 ± 0.10.0 ± 0.05.8 ± 0.224.5 ± 0.60.1 ± 0.0
      BioSt740.2 ± 0.01.6 ± 0.14.1 ± 0.30.2 ± 0.00.2 ± 0.05.7 ± 0.128.0 ± 2.40.9 ± 0.1
      BioSt750.4 ± 0.00.3 ± 0.021.6 ± 0.10.1 ± 0.00.3 ± 0.046.4 ± 3.126.4 ± 1.134.5 ± 2.0
      BioSt7615.2 ± 0.713.8 ± 1.145.0 ± 2.00.6 ± 0.056.5 ± 3.177.9 ± 2.18.1 ± 0.50.4 ± 0.0
      BioSt8019.9 ± 0.17.0 ± 0.04.0 ± 0.24.5 ± 0.113.5 ± 0.913.6 ± 1.213.8 ± 1.04.2 ± 0.0
      BioSt817.7 ± 0.720.0 ± 1.06.8 ± 0.60.3 ± 0.06.2 ± 0.06.1 ± 0.622.4 ± 0.40.0 ± 0.0
      BioSt8313.5 ± 0.236.6 ± 1.048.8 ± 0.811.3 ± 0.417.7 ± 0.24.1 ± 0.063.1 ± 3.054.3 ± 2.8
      BioSt8520.2 ± 1.721.2 ± 0.330.4 ± 2.34.8 ± 0.38.0 ± 0.32.8 ± 0.034.5 ± 3.1ND
      BioSt917.5 ± 0.521.0 ± 1.06.9 ± 0.40.2 ± 0.05.6 ± 0.59.5 ± 0.830.6 ± 0.30.1 ± 0.0
      BioSt9314.0 ± 0.87.6 ± 0.67.1 ± 0.40.2 ± 0.06.1 ± 0.68.1 ± 0.719.1 ± 1.00.1 ± 0.0
      BioSt977.6 ± 0.55.6 ± 0.46.2 ± 0.50.1 ± 0.06.8 ± 0.427.8 ± 2.418.6 ± 1.20.2 ± 0.0
      BioSt9917.0 ± 0.719.5 ± 0.424.8 ± 2.20.8 ± 0.021.6 ± 1.813.5 ± 1.010.5 ± 1.10.6 ± 0.1
      BioSt1008.6 ± 1.412.6 ± 1.811.0 ± 1.60.2 ± 0.07.3 ± 0.49.6 ± 0.421.4 ± 3.90.1 ± 0.0
      BioSt1024.1 ± 0.615.0 ± 1.33.8 ± 0.20.1 ± 0.06.8 ± 0.510.1 ± 1.823.1 ± 1.80.1 ± 0.0
      BioSt1047.9 ± 1.820.6 ± 1.85.4 ± 1.60.1 ± 0.06.8 ± 0.910.1 ± 0.723.4 ± 1.60.1 ± 0.0
      BioSt1086.8 ± 0.512.8 ± 1.24.5 ± 0.30.1 ± 0.07.9 ± 0.611.2 ± 0.913.2 ± 0.40.1 ± 0.0
      BioSt10921.3 ± 1.514.3 ± 1.115.4 ± 1.10.0 ± 0.011.3 ± 0.018.6 ± 1.212.5 ± 1.10.3 ± 0.0
      BioSt1109.7 ± 0.917.3 ± 1.03.2 ± 0.20.1 ± 0.07.8 ± 0.74.7 ± 0.55.6 ± 0.70.1 ± 0.0
      BioSt1129.2 ± 0.44.4 ± 0.97.1 ± 0.50.1 ± 0.03.4 ± 0.22.5 ± 0.214.4 ± 1.30.1 ± 0.0
      BioSt11516.6 ± 1.514.7 ± 1.215.2 ± 1.20.9 ± 0.18.0 ± 0.817.8 ± 1.214.9 ± 1.21.9 ± 0.1
      BioSt11812.5 ± 1.21.3 ± 0.03.6 ± 0.31.2 ± 0.00.1 ± 0.06.8 ± 0.52.6 ± 0.11.8 ± 0.1
      BioSt11922.1 ± 1.812.9 ± 1.221.0 ± 1.20.8 ± 0.17.7 ± 0.415.0 ± 0.819.9 ± 1.72.0 ± 0.6
      BioSt12127.5 ± 2.01.1 ± 0.121.4 ± 1.21.1 ± 0.012.8 ± 1.211.4 ± 1.113.0 ± 1.00.2 ± 0.0
      BioSt12320.4 ± 1.81.8 ± 0.120.5 ± 1.41.2 ± 0.13.9 ± 0.29.6 ± 0.412.1 ± 1.10.2 ± 0.0
      BioSt12722.1 ± 1.09.5 ± 0.618.6 ± 1.40.7 ± 0.09.0 ± 0.613.3 ± 1.014.4 ± 1.00.2 ± 0.0
      BioSt13211.1 ± 1.113.6 ± 1.132.3 ± 3.30.3 ± 0.00.2 ± 0.05.6 ± 0.410.0 ± 0.70.1 ± 0.0
      BioSt13426.9 ± 2.53.0 ± 0.320.4 ± 2.00.5 ± 0.018.5 ± 1.32.3 ± 0.212.9 ± 0.80.01 ± 0.0
      BioSt16111.2 ± 0.88.0 ± 0.214.6 ± 1.31.2 ± 0.17.7 ± 0.59.4 ± 0.714.8 ± 1.10.1 ± 0.0
      BioSt16228.9 ± 1.423.5 ± 0.129.2 ± 2.81.9 ± 0.115.7 ± 1.323.9 ± 2.122.3 ± 1.70.2 ± 0.0
      BioSt16465.8 ± 4.999.6 ± 7.9105.9 ± 8.41.9 ± 0.114.9 ± 1.225.2 ± 1.540.7 ± 1.91.4 ± 0.0
      BioSt16969.7 ± 2.297.8 ± 2.168.3 ± 3.70.4 ± 0.019.9 ± 0.728.6 ± 1.731.0 ± 0.63.2 ± 0.4
      BioSt17143.5 ± 3.5ND53.4 ± 2.10.2 ± 0.019.4 ± 1.7ND44.5 ± 1.07.6 ± 0.6
      BioSt17264.0 ± 4.5NDND0.2 ± 0.018.7 ± 1.1ND42.3 ± 2.23.8 ± 0.0
      BioSt17341.9 ± 3.9ND46.3 ± 3.016.6 ± 1.414.8 ± 1.3ND45.3 ± 2.911.0 ± 1.1
      1 ND = not detectable.
      Similar to acetaldehyde, lactic acid production also varied depending on the isolates and the culture conditions. In anaerobic SM17, BioSt55 formed the highest amount (57.7 ± 0.0), whereas BioSt71 produced the lowest (0.0 ± 0.0 mg/kg). Under aerobic conditions of SM17, lactic acid was formed by BioSt76 the most (77.9 ± 0.0 mg/kg) and by BioSt38 the least (1.7 ± 0.2 mg/kg). In LM17, maximum amount of acetaldehyde was found in BioSt83 (63.1 ± 0.0 mg/kg) and minimum in BioSt118 (2.6 ± 0.3 mg/kg). For milk, BioSt83 was the most productive strain (54.3 ± 0.0 mg/kg), whereas BioSt30 was the least productive (0.0 ± 0.0 mg/kg).
      Considering the fact that edible yogurts are made of milk, the amounts of the metabolites produced in milk by the strains of Strep. thermophilus that generated the highest amount of acetaldehyde (BioSt164) and lactic acid (BioSt76) were compared. They were able to produce as low as 1.8 and 0.5% of acetaldehyde and lactic acid produced in their best conditions, respectively, and the differences were calculated to be statistically significant (P < 0.001).

      Metabolite Production by L. bulgaricus Isolates

      As presented in Table 2, different isolates of L. bulgaricus showed varying metabolite-production abilities in each culture condition. In both anaerobic and aerobic MRS, for instance, the highest amount of acetaldehyde was generated by BioLb130 (77.3 ± 2.6 and 126.9 ± 0.2 mg/kg, respectively), whereas the lowest was formed by BioLb199 (0.3 ± 0.1 mg/kg) under anaerobic and by BioLb198 (0.7 ± 0.0 mg/kg) under aerobic conditions. Among the isolates grown in LM17, however, BioLb152 was the most acetaldehyde-producing strain (78.8 ± 3.2 mg/kg), whereas BioLb180 was the least productive (0.5 ± 0.1 mg/kg). As for milk, BioLb181 produced acetaldehyde the most (58.0 ± 0.0 mg/kg), and BioLb183 produced it the least (0.4 ± 0.1 mg/kg).
      Table 2Amounts (means ± SD) of metabolites acetaldehyde and lactic acid produced by 35 strains of Lactobacillus bulgaricus under various culture conditions
      StrainAcetaldehyde (mg/kg)Lactic acid (mg/kg)
      MRS
      MRS=de Man, Rogosa, and Sharpe agar.
      		LM17 agarMilkMRSLM17 agarMilk
      AnaerobicAerobicAnaerobicAerobic
      BioLb6563.6 ± 1.030.8 ± 0.559.6 ± 4.46.5 ± 0.55.4 ± 0.215.3 ± 1.112.8 ± 1.20.7 ± 0.1
      BioLb736.9 ± 0.0ND
      ND=not detectable.
      		2.5 ± 0.1ND14.2 ± 0.23.0 ± 0.295.1 ± 0.00.1 ± 0.0
      BioLb8968.7 ± 5.862.4 ± 4.862.6 ± 3.88.3 ± 0.625.6 ± 2.121.4 ± 1.319.7 ± 1.30.0 ± 0.0
      BioLb9427.8 ± 1.115.4 ± 1.377.5 ± 2.56.3 ± 0.52.9 ± 0.25.0 ± 0.316.0 ± 1.60.1 ± 0.0
      BioLb9861.3 ± 4.858.5 ± 7.059.5 ± 3.67.7 ± 0.422.6 ± 2.017.6 ± 1.326.1 ± 2.20.0 ± 0.0
      BioLb13077.3 ± 2.6126.9 ± 5.277.8 ± 2.816.1 ± 0.823.7 ± 1.147.0 ± 2.413.0 ± 1.10.1 ± 0.0
      BioLb15115.2 ± 1.215.9 ± 1.20.5 ± 0.011.6 ± 1.15.0 ± 0.13.0 ± 0.25.4 ± 0.30.1 ± 0.0
      BioLb15256.3 ± 4.9ND78.9 ± 3.2ND0.6 ± 0.0ND12.0 ± 1.1ND
      BioLb15342.1 ± 2.912.2 ± 0.575.8 ± 4.49.0 ± 0.31.7 ± 0.14.5 ± 0.411.4 ± 1.10.1 ± 0.0
      BioLb154ND12.8 ± 0.868.7 ± 1.812.8 ± 1.14.8 ± 0.34.7 ± 0.318.1 ± 1.20.1 ± 0.0
      BioLb15522.2 ± 2.022.3 ± 2.269.5 ± 4.722.2 ± 1.34.2 ± 0.4103.5 ± 4.127.9 ± 0.90.1 ± 0.0
      BioLb157ND14.3 ± 0.670.4 ± 2.324.5 ± 1.76.8 ± 0.25.0 ± 0.919.6 ± 0.20.1 ± 0.0
      BioLb15916.2 ± 1.213.3 ± 0.966.5 ± 6.514.5 ± 0.04.7 ± 0.25.4 ± 0.321.3 ± 2.10.1 ± 0.0
      BioLb16035.5 ± 2.125.5 ± 1.115.5 ± 0.723.6 ± 1.812.4 ± 1.011.3 ± 0.750.5 ± 2.416.7 ± 1.4
      BioLb17863.9 ± 3.3ND59.4 ± 4.226.3 ± 1.216.6 ± 0.815.4 ± 1.216.0 ± 1.211.8 ± 1.1
      BioLb17948.2 ± 3.163.6 ± 5.234.0 ± 2.74.6 ± 0.3ND5.5 ± 0.219.8 ± 1.2ND
      BioLb18012.1 ± 1.19.1 ± 0.40.5 ± 0.019.7 ± 1.23.6 ± 0.311.4 ± 0.43.6 ± 0.125.3 ± 2.1
      BioLb1815.9 ± 0.166.0 ± 4.02.2 ± 0.258.0 ± 3.125.9 ± 1.238.4 ± 3.0ND25.9 ± 1.1
      BioLb1830.6 ± 0.06.6 ± 0.2ND0.4 ± 0.019.9 ± 1.215.5 ± 1.34.4 ± 0.123.5 ± 2.0
      BioLb184ND10.0 ± 0.20.7 ± 0.119.4 ± 1.520.7 ± 1.223.8 ± 2.017.5 ± 1.110.5 ± 1.1
      BioLb18511.5 ± 1.116.4 ± 1.63.0 ± 0.228.9 ± 2.120.9 ± 1.242.4 ± 3.11.3 ± 0.1ND
      BioLb18646.1 ± 3.03.4 ± 0.33.0 ± 0.118.3 ± 1.115.8 ± 1.15.8 ± 0.111.2 ± 1.09.2 ± 0.7
      BioLb1870.9 ± 0.05.1 ± 0.0ND0.8 ± 0.017.9 ± 1.039.1 ± 3.243.3 ± 4.28.9 ± 0.3
      BioLb1881.8 ± 0.12.6 ± 0.123.9 ± 2.026.7 ± 1.812.5 ± 1.142.9 ± 3.911.7 ± 1.08.7 ± 0.8
      BioLb1898.9 ± 0.721.8 ± 0.21.1 ± 0.17.3 ± 0.419.2 ± 1.820.0 ± 2.028.1 ± 0.02.5 ± 0.1
      BioLb19022.8 ± 0.110.6 ± 0.16.9 ± 0.16.7 ± 0.121.7 ± 0.212.1 ± 0.110.5 ± 0.25.7 ± 0.1
      BioLb1910.89 ± 0.05.2 ± 0.0ND2.6 ± 0.11.0 ± 0.13.2 ± 0.1ND0.7 ± 0.1
      BioLb1926.2 ± 0.12.5 ± 0.21.1 ± 0.04.3 ± 0.20.6 ± 0.222.3 ± 0.2ND3.5 ± 0.0
      BioLb19312.9 ± 0.060.9 ± 2.16.4 ± 3.123.3 ± 2.016.4 ± 1.29.7 ± 0.112.2 ± 0.25.1 ± 0.4
      BioLb19438.4 ± 2.19.4 ± 0.21.8 ± 0.13.4 ± 0.014.7 ± 0.13.0 ± 0.03.3 ± 0.1ND
      BioLb1950.4 ± 0.022.8 ± 0.08.4 ± 0.13.4 ± 0.01.0 ± 0.012.7 ± 0.12.4 ± 0.11.3 ± 0.2
      BioLb1960.4 ± 0.021.0 ± 0.06.1 ± 0.124.1 ± 0.01.5 ± 0.113.3 ± 0.13.9 ± 0.312.0 ± 1.2
      BioLb19719.1 ± 0.165.4 ± 0.05.5 ± 0.223.2 ± 0.06.1 ± 0.025.4 ± 0.838.2 ± 2.116.6 ± 1.6
      BioLb19852.4 ± 0.20.7 ± 0.021.7 ± 0.019.8 ± 0.015.3 ± 0.1ND12.1 ± 0.118.2 ± 0.1
      BioLb1990.31 ± 0.0ND18.2 ± 1.0ND21.6 ± 1.138.5 ± 3.170.8 ± 4.113.1 ± 1.1
      1 MRS = de Man, Rogosa, and Sharpe agar.
      2 ND = not detectable.
      Similarly, lactic acid production changed remarkably depending on the isolate and the culture condition it was grown. In MRS, BioLb181 was the most productive isolate (25.9 ± 0.2 mg/kg) when oxygen was depleted. BioLb152, on the other hand, was found to be the least-productive strain (0.6 ± 0.1 mg/kg) in the same state. When oxygen was present in MRS, BioLb155 showed the highest (103.5 ± 4.1 mg/kg) and BioLb73 showed the lowest (3.0 ± 0.2 mg/kg) lactic acid production. In LM17, BioLb73 generated lactic acid the most (95.1 ± 0.0 mg/kg), whereas BioLb185 produced it the least (1.3 ± 0.2 mg/kg). Lastly, when milk was used as the growth media, BioLb181 and BioLb98 manufactured the highest (25.9 ± 0.1 mg/kg) and the lowest (0.0 ± 0.0 mg/kg) amount of lactic acid, respectively.
      A comparison for the metabolites produced in milk and other media was also made for L. bulgaricus, and it was found that the amount of the metabolites produced by L. bulgaricus strains in milk was significantly (P < 0.001) lower than the amount generated in their best conditions. Acetaldehyde produced in milk by the most acetaldehyde-productive strain (BioLb130) was only 12.7% of its highest performance, and lactic acid produced in milk by the most lactic acid–producing strain (BioLb155) was only 0.1% of what was generated in aerobic MRS.

      Discussion

      Bacteria used in starter cultures during the manufacture of yogurt are of great importance because they have the ability to directly influence the nutritional and commercial value of the final product. In the yogurt industry, commercially available strains of 2 microorganisms, Strep. thermophilus and L. bulgaricus, are most commonly used. Although these strains are able to produce the yogurt with desirable properties in a profitable way, some wild strains to be discovered may be superior to them and increase the qualities of the product, decrease the expenses for yogurt production, or produce new types of yogurt with alternative properties. In this study, we aimed to isolate some wild strains of Strep. thermophilus and L. bulgaricus from traditionally made Turkish yogurts to investigate their ability to produce flavor-forming metabolites: acetaldehyde and lactic acid.
      In the literature, it has been mentioned that acetaldehyde-producing abilities of the LAB species are rather dissimilar despite the fact that they both are capable of generating the metabolite in sufficient amounts to produce yogurt with an acceptable taste (
      • Ozer B.
      • Atasoy F.
      Effect of addition of amino acids, treatment with beta-galactosidase and use of heat-shocked cultures on the acetaldehyde level in yogurt.
      Int. J. Dairy Technol. 2002; 55: 166-170
      ). By indicating its dependence on the strain used, the optimum physiological conditions for acetaldehyde production were summarized as 37°C at pH 4.2 in heated milk at 65°C for 30 min in Strep. thermophilus (
      • Singh J.
      Influence of heat treatment of milk and incubation temperature on S. thermophilus and L. acidophilus..
      Milchwissenschaft. 1983; 38: 347-348
      ). Streptococcus thermophilus has been reported to produce acetaldehyde in the range of 1.0 to 13.5 mg/kg, whereas L. bulgaricus has been found to generate it between 1.4 and 77.5 mg/kg in milk (
      • Routray W.
      • Mishra H.N.
      Scientific and technical aspects of yogurt aroma and taste: A review.
      Compr. Rev. Food Sci. Food Safe. 2011; 10: 208-220
      ). Acetaldehyde production has also been shown to be time dependent. It has been demonstrated that both Strep. thermophilus and L. bulgaricus were able to produce the highest amount of acetaldehyde in 115°C preheated milk with pH 6.2 to 6.3 at 45°C around the 22nd hour of fermentation (
      • Beshkova D.
      • Smiova E.
      • Frengova G.
      • Simov Z.
      Production of flavour compounds by yogurt starter cultures.
      J. Ind. Microbiol. Biotechnol. 1998; 20: 180-186
      ). Our measurements revealed an extended range for the acetaldehyde generated by Strep. thermophilus in the same media, where its amount ranged between 0.0 and 21.1 mg/kg. Albeit evidently higher than the amount produced by Strep. thermophilus, acetaldehyde production by L. bulgaricus was found to be lower than what was presented in the literature, remaining between 0.4 and 58.0 mg/kg. Of all the isolates that were scrutinized in terms of their abilities to form acetaldehyde in milk, only 4 were found to generate the metabolite within the acceptable range (23–40 mg/kg) that is suggested for a well-flavored yogurt (
      • Cheng H.F.
      Volatile flavor compounds in yogurt: A review.
      Crit. Rev. Food Sci. Nutr. 2010; 50: 938-950
      ). Surprisingly, all 4 strains belonged to L. bulgaricus species, whereas none from Strep. thermophilus was able to reach even the minimum limit.
      Streptococcus thermophilus and L. bulgaricus are 2 species of LAB that are capable of producing 2 isomers of lactic acid [i.e., l(+) and d(−)]. Optimal lactic acid production is known to be strain dependent. However, the best value for Strep. thermophilus was measured in whey permeate at 42°C at pH 5.8, whereas for L. bulgaricus, it was detected in molasses at 47°C (
      • Hofvendahl K.
      • Hahn-Hägerdal B.
      Factors affecting the fermentative lactic acid production from renewable resources.
      Enzyme Microb. Technol. 2000; 26 (): 87-107
      ). In our study, we used HPLC to evaluate the levels of lactic acid produced by the bacteria. As it was shown previously, HPLC has the potential to separate d(−) and l(+) lactic acid and to measure their levels independently (
      • Olieman C.
      • de Vries E.S.
      Determination of d- and l-lactic acid in fermented dairy products with HPLC.
      Neth. Milk Dairy J. 1988; 42: 111-120
      ). Although this separation requires a chiral column that was not used in our experiments, the reference we used for the system enabled us to detect primarily the l(+) isomer. Because the influence of lactic acid on yogurt aroma is not only related to its total amount present in the fermented product but also to the ratio of the 2 isoforms [d(−) or l(+)] found in it, it was infeasible for us to constitute a direct relation between the measured amount of lactic acid and its contribution to the yogurt flavor.
      Titratable acidity may have been measured to monitor pH change in the media studied. However, as it was discussed by
      • Sherbon J.W.
      Physical properties of milk.
      in: Wong N.P. Fundamentals of Dairy Chemistry. Van Nostrand Reinhold, New York, NY1988: 409-460
      , acidity of the media is dependable on various factors, such as the temperature and light conditions, the buffer system present in the media, and even the researcher who performs the task. Although electrometric determination of pH is considered to be convenient for the routine analysis in the industry (
      • Tamime A.Y.
      • Robinson R.K.
      Yogurt: Science and Technology. 3rd. Woodhead Publishing Limited, Abingdon, UK2007
      ), lactic acid levels are used as international standards in determining the quality of yogurt (
      International Dairy Federation, Brussels (IDF)
      General Standard of Identity for Milk Products Obtained from Fermented Milks. Standard no. 163.
      Int. Dairy Fed., Brussels, Belgium1992
      ). As a result, we found it more suitable for our purpose, which is to investigate the potential use of the natural isolates in yogurt production, to measure lactic acid levels as milligrams per kilogram of media instead of pH monitoring.
      In our study, it was observed that the production of the metabolites varied not only among the species but also among the strains of the same species. Considering the fact that the strains were isolated from different regions of Turkey, with varying environmental factors, such as temperature, humidity, and the milk content due to the diet on which the animals are fed, it is expected to see such a difference because it was demonstrated that dairy environment affected the expression of the genes that were important in metabolic, physiological, and functional roles in LAB (
      • Klaenhammer T.R.
      • Azcarate-Peril M.A.
      • Altermann E.
      • Barrangou R.
      Influence of the dairy environment on gene expression and substrate utilization in lactic acid bacteria.
      J. Nutr. 2007; 137: 748S-750S
      ).
      Despite the fact that each wild strain was unique in its potential to generate the metabolite of interest, the strains of L. bulgaricus were, in general, better at forming both metabolites. Besides, when anaerobic and aerobic conditions were compared, it was found that all isolates showed the best performance when they were grown in aerobic conditions. Oxygen presence seemed to be especially important for acetaldehyde production by both species for the lowest values of both species were determined in anaerobic conditions. As far as the media are concerned, L. bulgaricus was at its best to produce both metabolites when grown in its most suitable mixture (aerobic MRS). Streptococcus thermophilus, on the other hand, produced the highest lactic acid in its special media (aerobic SM17), whereas it generated the maximum acetaldehyde in LM17, a common media used for both species.
      In addition to flavor, texture is one of the most essential components of yogurt quality. The characteristic texture of yogurt is mainly generated by the coagulation of the milk in which the starters were incubated. Although the evaluation of the texture was not in the scope of this study, it is worth noting that all strains examined were able to coagulate the milk, indicating a possible potential to contribute to the desired sensory properties.
      Overall, the observation that only a few of the strains isolated from traditional yogurts, which are generally highly flavored, showed the ability to produce the most important flavor components in sufficient amounts agrees with the literature indicating that combining the 2 species in a starter culture synergistically affects the taste of yogurt compared with situations where a single culture system is used (
      • Georgala A.
      • Tsakalidou K.
      • Kandarakis E.
      • Kalantzopoulos G.
      Flavour production in ewe’s milk and ewe’s milk yogurt, by single strains and combinations of Streptococcus thermophilus and Lactobacillus delbrueckii subsp bulgaricus, isolated from traditional Greek yogurt.
      Lait. 1995; 75: 271-283
      ). Accordingly, it is coherent to expect that the total amount of the metabolites to be produced when these strains are combined may be different from the simple sum of the amounts produced by each strain separately. Bearing in mind that lactose is used as the starting material in both acetaldehyde and lactic acid production in the cells and that each species has a unique ability to metabolize it, it seems inevitable that the species will compete for lactose, and therefore the actual values for each metabolite will be deviated from any simple mathematical prediction. Herewith, it is also reasonable to suggest that the best starter culture mix that could be composed by using the strains tested in this study can only be determined experimentally.
      The results generated through the research constitute the first set of data regarding the investigation of the flavor-forming metabolites produced by the LAB strains isolated from homemade Turkish yogurts. Thus, our results provide an undeniable originality in terms of natural LAB strains identified in the literature. Additionally, discovering some characteristics of these natural isolates also bears the potential to be useful in industrial manufacture of yogurt with a certain quality.

      Acknowledgments

      This work was funded by The Scientific and Technological Research Council of Turkey (Project No: 110 O 218).

      References

        • Adolfsson O.
        • Meydani S.N.
        • Russell R.M.
        Yogurt and gut function.
        Am. J. Clin. Nutr. 2004; 80: 245-256
        View in Article
        • Akyol I.
        • Serdaroglu K.
        • Gezginc Y.
        • Dayisoylu K.S.
        • Ekinci M.S.
        • Ozkose E.
        Redirection of pyruvate pathway of lactic acid bacteria to improve cheese quality.
        Food Biotechnol. 2009; 23: 200-213
        View in Article
        • Ayad E.H.E.
        • Verheul A.
        • de Jong C.
        • Wouters J.T.M.
        • Smit G.
        Flavour forming abilities and amino acid requirements of Lactococcus lactis strains isolated from artisanal and non-dairy origin.
        Int. Dairy J. 1999; 9: 725-735
        View in Article
        • Ayad E.H.E.
        • Verheul A.
        • Wouters J.T.M.
        • Smit G.
        Application of wild starter cultures for flavour development in pilot plant cheese making.
        Int. Dairy J. 2000; 10: 169-179
        View in Article
        • Beshkova D.
        • Smiova E.
        • Frengova G.
        • Simov Z.
        Production of flavour compounds by yogurt starter cultures.
        J. Ind. Microbiol. Biotechnol. 1998; 20: 180-186
        View in Article
        • Bolotin A.
        • Quinquis B.
        • Renault P.
        • Sorokin A.
        • Ehrlich S.D.
        • Kulakauskas S.
        • Lapidus A.
        • Goltsman E.
        • Mazur M.
        • Pusch G.D.
        • Fonstein M.
        • Overbeek R.
        • Kyprides N.
        • Purnelle B.
        • Prozzi D.
        • Ngui K.
        • Masuy D.
        • Hancy F.
        • Burteau S.
        • Boutry M.
        • Delcour J.
        • Goffeau A.
        • Hols P.
        Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus.
        Nat. Biotechnol. 2004; 22: 1554-1558
        View in Article
        • Chaves A.C.S.D.
        • Fernandez M.
        • Lerayer A.L.S.
        • Mierau I.
        • Kleerebezem M.
        • Hugenholtz J.
        Metabolic engineering of acetaldehyde production by Streptococcus thermophilus.
        Appl. Environ. Microbiol. 2002; 68: 5656-5662
        View in Article
        • Cheng H.F.
        Volatile flavor compounds in yogurt: A review.
        Crit. Rev. Food Sci. Nutr. 2010; 50: 938-950
        View in Article
        • De Man J.C.
        • Rogosa M.
        • Sharpe M.E.
        A medium for the cultivation of lactobacilli.
        J. Appl. Bacteriol. 1960; 23: 130-135
        View in Article
        • Delorme C.
        • Bartholini C.
        • Luraschi M.
        • Pons N.
        • Loux V.
        • Almeida M.
        • Guédon E.
        • Gibrat J.F.
        • Renault P.
        Complete genome sequence of the pigmented Streptococcus thermophilus strain JIM8232.
        J. Bacteriol. 2011; 193: 5581-5582
        View in Article
        • Georgala A.
        • Tsakalidou K.
        • Kandarakis E.
        • Kalantzopoulos G.
        Flavour production in ewe’s milk and ewe’s milk yogurt, by single strains and combinations of Streptococcus thermophilus and Lactobacillus delbrueckii subsp bulgaricus, isolated from traditional Greek yogurt.
        Lait. 1995; 75: 271-283
        View in Article
        • Ginovart M.
        • Lopez D.
        • Valls J.
        • Silbert M.
        Simulation modelling of bacterial growth in yogurt.
        Int. J. Food Microbiol. 2002; 73: 415-425
        View in Article
        • Hao P.
        • Zheng H.
        • Yu Y.
        • Ding G.
        • Gu W.
        • Chen S.
        • Yu Z.
        • Ren S.
        • Oda M.
        • Konno T.
        • Wang S.
        • Li X.
        • Ji Z.S.
        • Zhao G.
        Complete sequencing and pan-genomic analysis of Lactobacillus delbrueckii ssp. bulgaricus reveal its genetic basis for industrial yogurt production.
        PLoS ONE. 2011; 6: e15964
        View in Article
        • Hofvendahl K.
        • Hahn-Hägerdal B.
        Factors affecting the fermentative lactic acid production from renewable resources.
        Enzyme Microb. Technol. 2000; 26 (): 87-107
        View in Article
        • International Dairy Federation, Brussels (IDF)
        General Standard of Identity for Milk Products Obtained from Fermented Milks. Standard no. 163.
        Int. Dairy Fed., Brussels, Belgium1992
        View in Article
        • Ito Y.
        • Sasaki T.
        Cloning and nucleotide sequencing of l-lactate dehydrogenase gene from Streptococcus thermophilus M-192.
        Biosci. Biotechnol. Biochem. 1994; 58: 1569-1573
        View in Article
        • Kabak B.
        • Dobson A.D.W.
        An introduction to the traditional fermented foods and beverages of Turkey.
        Crit. Rev. Food Sci. Nutr. 2011; 51: 248-260
        View in Article
        • Kao Y.T.
        • Liu Y.S.
        • Shyu Y.T.
        Identification of Lactobacillus spp. in probiotic products by real-time PCR and melting curve analysis.
        Food Res. Int. 2007; 40: 71-79
        View in Article
        • Klaenhammer T.R.
        • Azcarate-Peril M.A.
        • Altermann E.
        • Barrangou R.
        Influence of the dairy environment on gene expression and substrate utilization in lactic acid bacteria.
        J. Nutr. 2007; 137: 748S-750S
        View in Article
        • Magenis R.B.
        • Prudencio E.S.
        • Amboni R.D.M.C.
        • Junior N.G.C.
        • Oliveira R.V.B.
        • Soldi V.
        • Benedet H.D.
        Compositional and physical properties of yogurts manufactured from milk and whey cheese concentrated by ultrafiltration.
        Int. J. Food Sci. Technol. 2006; 41: 560-568
        View in Article
        • Olieman C.
        • de Vries E.S.
        Determination of d- and l-lactic acid in fermented dairy products with HPLC.
        Neth. Milk Dairy J. 1988; 42: 111-120
        View in Article
        • Ozer B.
        • Atasoy F.
        Effect of addition of amino acids, treatment with beta-galactosidase and use of heat-shocked cultures on the acetaldehyde level in yogurt.
        Int. J. Dairy Technol. 2002; 55: 166-170
        View in Article
        • Panagiotidis P.
        • Tzia C.
        Effect of milk composition and heating on flavor and aroma of yogurt.
        Food Flavors and Chemistry: Advances of the New Millennium. Royal Soc. Chem., Cambridge, UK2001: 160-167
        View in Article
        • Pastink M.I.
        • Sieuwertsa S.
        • de Bok F.A.M.
        • Janssen P.W.M.
        • Teusink B.
        • van Hylckama Vlieg J.E.T.
        • Hugenholtza J.
        Genomics and high-throughput screening approaches for optimal flavour production in dairy fermentation.
        Int. Dairy J. 2008; 18: 781-789
        View in Article
        • Routray W.
        • Mishra H.N.
        Scientific and technical aspects of yogurt aroma and taste: A review.
        Compr. Rev. Food Sci. Food Safe. 2011; 10: 208-220
        View in Article
        • Sherbon J.W.
        Physical properties of milk.
        in: Wong N.P. Fundamentals of Dairy Chemistry. Van Nostrand Reinhold, New York, NY1988: 409-460
        View in Article
        • Singh J.
        Influence of heat treatment of milk and incubation temperature on S. thermophilus and L. acidophilus..
        Milchwissenschaft. 1983; 38: 347-348
        View in Article
        • Sun Z.
        • Chen X.
        • Wang J.
        • Zhao W.
        • Shao Y.
        • Guo Z.
        • Zhang X.
        • Zhou Z.
        • Sun T.
        • Wang L.
        • Meng H.
        • Zhang H.
        • Chen W.
        Complete genome sequence of Lactobacillus delbrueckii ssp. bulgaricus strain ND02.
        J. Bacteriol. 2011; 193: 3426-3427
        View in Article
        • Tabasco R.
        • Paarup T.
        • Janer C.
        • Pelaez C.
        • Requena T.
        Selective enumeration and identification of mixed cultures of Streptococcus thermophilusLactobacillus delbrueckii subsp bulgaricusL. acidophilusL. paracasei subsp paracasei and Bifidobacterium lactis in fermented milk.
        Int. Dairy J. 2007; 17: 1107-1114
        View in Article
        • Tamime A.Y.
        • Robinson R.K.
        Yogurt: Science and Technology. 3rd. Woodhead Publishing Limited, Abingdon, UK2007
        View in Article
        • Terzaghi B.E.
        • Sandine W.E.
        Improved medium for lactic streptococci and their bacteriophages.
        Appl. Microbiol. 1975; 29: 807-813
        View in Article
        • Zhang Q.L.
        • Ren J.Y.
        • Zhao H.F.
        • Zhao M.M.
        • Xu J.Y.
        • Zhao Q.Z.
        Influence of casein hydrolysates on the growth and lactic acid production of Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus.
        Int. J. Food Sci. Technol. 2011; 46: 1014-1020
        View in Article

      Article info

      Publication history

      Published online: December 26, 2014
      Accepted: September 30, 2014
      Received: June 4, 2014

      Identification

      DOI: https://doi.org/10.3168/jds.2014-8447

      Copyright

      © 2015 American Dairy Science Association. Published by Elsevier Inc.

      User license

      Elsevier user license |
      How you can reuse Information Icon
      Elsevier user license

      Permitted

      For non-commercial purposes:

      • Read, print & download
      • Text & data mine
      • Translate the article

      Not Permitted

      • Reuse portions or extracts from the article in other works
      • Redistribute or republish the final article
      • Sell or re-use for commercial purposes

      Elsevier's open access license policy

      ScienceDirect

      Access this article on ScienceDirect

      Linked Article

      The content on this site is intended for healthcare professionals.


      We use cookies to help provide and enhance our service and tailor content. To update your cookie settings, please visit the Cookie Preference Center for this site.
      Copyright © 2023 Elsevier Inc. except certain content provided by third parties.


      RELX