Advertisement

Menthol stimulates calcium absorption in the rumen but not in the jejunum of sheep

Open ArchivePublished:December 23, 2020DOI:https://doi.org/10.3168/jds.2020-19372

      ABSTRACT

      Stimulation of Ca2+ absorption can counteract hypocalcemia at the onset of lactation. The plant bioactive lipid compound (PBLC) menthol is an agonist for nonselective cation channels of the transient receptor potential (TRP) family. It acutely stimulated Ca2+ absorption in ruminal epithelia of nonadapted animals ex vivo and caused higher plasma Ca2+ concentrations in cows and sheep in vivo. To elucidate the pathway by which menthol feeding increases plasma Ca2+ level, the present study aimed to investigate the long-term dose-dependent effects of dietary menthol-rich PBLC on Ca2+ absorption and mRNA abundances of TRP channels in both rumen and jejunum. Twenty-four growing Suffolk sheep were equally distributed to a Con, PBLC-L, and PBLC-H group, which received 0, 80, and 160 mg/d of a menthol-rich PBLC. After 4 wk, ruminal and jejunal epithelia were analyzed for mRNA abundances of TRPA1, TRPV3, TRPV5–6, and TRPM6–8 genes. The Ca2+ flux rates and electrophysiological properties of epithelia from rumen and mid-jejunum were measured in Ussing chambers in the presence and absence of mucosal Na+. Acute changes in Ca2+ flux rates were measured after mucosal application of 50 µM menthol. Ruminal epithelia had quantifiable transcripts of TRPV3 = TRPM6 > TRPM7 > TRPA1 with no difference among feeding groups. Jejunum had quantifiable transcripts of TRPM7 > TRPA1TRPM6TRPV6 > TRPV5, where TRPA1, TRPV5, and TRPV6 tended to decrease linearly with increasing PBLC dose. Absorptive net flux of Ca2+ was detected only in the rumen, whereas jejunum showed a high passive permeability to Ca2+. Net flux rates of Ca2+ in the rumen increased in a quadratic manner (highest in PBLC-L animals) and were systematically decreased with the omission of mucosal Na+. Short-circuit current increased in both PBLC feeding groups compared with Con only in the rumen. Acute application of menthol-stimulated mucosal-to-serosal and net Ca2+ flux rates only in ruminal epithelia with higher stimulation in PBLC-fed animals. We conclude that Ca2+ transport is mainly active and transcellular in the rumen. It most likely involves TRPV3 that can be stimulated by menthol. Pre-feeding of menthol-rich PBLC enhances ruminal Ca2+ absorption and sensitizes it to acute stimulation by menthol. By contrast, intestinal Ca2+ absorption is not sensitive to menthol stimulation. Menthol could be used as a tool to enhance ruminal Ca2+ absorption and to prevent hypocalcemia in dairy cows.

      Key words

      INTRODUCTION

      Dairy cows are at high risk of hypocalcemia and milk fever at the onset of lactation (
      • Martin-Tereso J.
      • Martens H.
      Calcium and magnesium physiology and nutrition in relation to the prevention of milk fever and tetany (dietary management of macrominerals in preventing disease).
      ). The number of subclinical cases far exceeds the number of clinical cases (
      • Houe H.
      • Ostergaard S.
      • Thilsing-Hansen T.
      • Jorgensen R.J.
      • Larsen T.
      • Sorensen J.T.
      • Agger J.F.
      • Blom J.Y.
      Milk fever and subclinical hypocalcaemia - An evaluation of parameters on incidence risk, diagnosis, risk factors and biological effects as input for a decision support system for disease control.
      ;
      • Roche J.R.
      • Berry D.P.
      Periparturient climatic, animal, and management factors influencing the incidence of milk fever in grazing systems.
      ). Subclinical hypocalcemia affects 6–25% of heifers, 29–41% of cows in the second lactation, and up to 54–60% of cows in the third lactation and beyond (
      • Reinhardt T.A.
      • Lippolis J.D.
      • McCluskey B.J.
      • Goff J.P.
      • Horst R.L.
      Prevalence of subclinical hypocalcemia in dairy herds.
      ;
      • Venjakob P.L.
      • Borchardt S.
      • Heuwieser W.
      Hypocalcemia-Cow-level prevalence and preventive strategies in German dairy herds.
      ). Although these animals show no clinical signs, they are more susceptible to secondary diseases (
      • Kimura K.
      • Reinhardt T.A.
      • Goff J.P.
      Parturition and hypocalcemia blunts calcium signals in immune cells of dairy cattle.
      ;
      • Chapinal N.
      • Carson M.
      • Duffield T.F.
      • Capel M.
      • Godden S.
      • Overton M.
      • Santos J.E.
      • LeBlanc S.J.
      The association of serum metabolites with clinical disease during the transition period.
      ;
      • Rodríguez E.M.
      • Aris A.
      • Bach A.
      Associations between subclinical hypocalcemia and postparturient diseases in dairy cows.
      ) with negative consequences for animal health and productivity (
      • McArt J.A.
      • Oetzel G.R.
      A stochastic estimate of the economic impact of oral calcium supplementation in postparturient dairy cows.
      ).
      One main hypocalcemia control strategy aims to increase gastrointestinal Ca2+ absorption by supplying high doses of oral Ca2+ salts or by injection of vitamin D3 and its metabolites (
      • Goff J.P.
      The monitoring, prevention, and treatment of milk fever and subclinical hypocalcemia in dairy cows.
      ;
      • Venjakob P.L.
      • Borchardt S.
      • Heuwieser W.
      Hypocalcemia-Cow-level prevalence and preventive strategies in German dairy herds.
      ). Intestinal Ca2+ absorption mainly occurs via channels of the transient receptor potential (TRP) family, especially TRPV6, in the jejunum (
      • Peng J.B.
      • Chen X.Z.
      • Berger U.V.
      • Vassilev P.M.
      • Tsukaguchi H.
      • Brown E.M.
      • Hediger M.A.
      Molecular cloning and characterization of a channel-like transporter mediating intestinal calcium absorption.
      ). It is responsive to calcitriol stimulation, whereas Ca2+ absorption in the rumen is not regulated by calcitriol (
      • Schröder B.
      • Goebel W.
      • Huber K.
      • Breves G.
      No effect of vitamin D3 treatment on active calcium absorption across ruminal epithelium of sheep.
      ;
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ).
      The exact mechanisms of ruminal Ca2+ absorption still remain unclear (
      • Wilkens M.R.
      • Muscher-Banse A.S.
      Review: Regulation of gastrointestinal and renal transport of calcium and phosphorus in ruminants.
      ;
      • Wilkens M.R.
      • Nelson C.D.
      • Hernandez L.L.
      • McArt J.A.A.
      Symposium review: Transition cow calcium homeostasis—Health effects of hypocalcemia and strategies for prevention.
      ). Earlier studies suggested the involvement of a Ca2+/H+ exchanger (
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ). Apical Ca2+ entry by this transporter was thought to be coupled to the extrusion of intracellular H+, the latter in parallel to H+ extrusion by the well-documented Na+/H+ exchanger (
      • Rabbani I.
      • Siegling-Vlitakis C.
      • Noci B.
      • Martens H.
      Evidence for NHE3-mediated Na transport in sheep and bovine forestomach.
      ;
      • Yang W.
      • Shen Z.
      • Martens H.
      An energy-rich diet enhances expression of Na+/H+ exchanger isoform 1 and 3 messenger RNA in rumen epithelium of goat.
      ). More recently, a nonselective cation channel, with characteristics of the TRP family, was proposed to mediate the apical entry of Ca2+ into the ruminal epithelium (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ;
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ). One characteristic of TRP channels is that they are stimulated by certain plant bioactive lipid compounds (PBLC), also known as essential oils (
      • Holzer P.
      TRP channels in the digestive system.
      ;
      • Nilius B.
      • Szallasi A.
      Transient receptor potential channels as drug targets: From the science of basic research to the art of medicine.
      ). The PBLC menthol, for example, acts as an agonist for various TRP channels with potent effects on TRPA1, TRPV3, and TRPM8 (
      • Macpherson L.J.
      • Hwang S.W.
      • Miyamoto T.
      • Dubin A.E.
      • Patapoutian A.
      • Story G.M.
      More than cool: Promiscuous relationships of menthol and other sensory compounds.
      ;
      • Vogt-Eisele A.K.
      • Weber K.
      • Sherkheli M.A.
      • Vielhaber G.
      • Panten J.
      • Gisselmann G.
      • Hatt H.
      Monoterpenoid agonists of TRPV3.
      ;
      • Karashima Y.
      • Damann N.
      • Prenen J.
      • Talavera K.
      • Segal A.
      • Voets T.
      • Nilius B.
      Bimodal action of menthol on the transient receptor potential channel TRPA1.
      ). Application of menthol to TRPV3 channels increases Ca2+ flux (
      • Schrapers K.T.
      • Sponder G.
      • Liebe F.
      • Liebe H.
      • Stumpff F.
      The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+.
      ). The menthol-sensitive TRPV3 channel was discovered on mRNA and protein level in the rumen of cattle (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ;
      • Liebe F.
      • Liebe H.
      • Kaessmeyer S.
      • Sponder G.
      • Stumpff F.
      The TRPV3 channel of the bovine rumen: localization and functional characterization of a protein relevant for ruminal ammonia transport.
      ). Moreover, the direct application of menthol in concentrations of 10 or 100 µM increased the absorptive Ca2+ flux across bovine ruminal epithelia by 32 to 54% ex vivo (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ). It was further demonstrated that the dietary supplementation of a blend of PBLC with menthol as the major active compound increased serum Ca2+ concentration in mid-lactation cows in vivo (
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ). Similarly, menthol-based PBLC pre-feeding tended to increase serum Ca2+ levels in growing sheep (
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ).
      It is an open question whether increased serum Ca2+ concentration after menthol supplementation in vivo originated from increased Ca2+ absorption in the rumen, the jejunum, or both. It is further unknown whether menthol solely acts as an acute agonist of TRP channels or whether it also modifies the expression of TRP channels during long-term supplementation. Finally, the functional role of the putative Ca2+/H+ exchanger in relation to TRP-mediated Ca2+ absorption is unclear in the rumen. To answer these open questions, a model study in sheep was designed to measure the changes in TRP channel expression, Ca2+ absorptive capacity, and menthol responsiveness of ruminal and jejunal epithelia after long-term supplementation with 2 doses of menthol-rich PBLC. To evaluate the possible involvement of a Ca2+/H+ exchanger, Ca2+ absorption was assessed in the presence and absence of luminal Na+. The absence of Na+ should abrogate apical Na+/H+ exchange and thus increase the H+ driving force for apical Ca2+/H+ exchange.

      MATERIALS AND METHODS

      Animals, Diet, and Feeding

      All experiments were performed in compliance with the German legislation on the welfare of experimental animals and communicated with the State Office for Health and Social Affairs (LAGeSo) Berlin (reference number G0141/17). The experiment was conducted in 2 runs with 12 growing Suffolk sheep in each run during June through August 2017. Animals were equally divided by A.K.P. into 3 dietary groups in a randomized block design with the aim to achieve equal sex and BW (considered as a block) distribution per group. In each run, 4 blocks of 3 sheep were housed in 4 available pens and received hay and water ad libitum plus 600 g/d of a pelleted concentrate. The concentrate was provided in 3 equal portions per day (at 0700, 1100, and 1500 h) and contained either no PBLC (Con), a low dose of PBLC (PBLC-L; 80 mg/d), or a high dose of PBLC (PBLC-H; 160 mg/d) with menthol as the main active ingredient (900 g/kg). Experimental design, feeding regimen, and chemical composition of hay and concentrate have been described in detail previously (
      • Patra A.K.
      • Park T.
      • Braun H.S.
      • Geiger S.
      • Pieper R.
      • Yu Z.
      • Aschenbach J.R.
      Dietary bioactive lipid compounds rich in menthol alter interactions among members of ruminal microbiota in sheep.
      ). Although feeding groups were blinded using color-coded feed during the original experiment, the results of the molecular biology experiments (September 2018 through September 2019) and Ussing chamber data (October 2018 through April 2019) of the present study were evaluated after the blinding was opened to assess already published data of this trial (
      • Patra A.K.
      • Geiger S.
      • Braun H.S.
      • Aschenbach J.R.
      Dietary supplementation of menthol-rich bioactive lipid compounds alters circadian eating behaviour of sheep.
      ,
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ,
      • Patra A.K.
      • Park T.
      • Braun H.S.
      • Geiger S.
      • Pieper R.
      • Yu Z.
      • Aschenbach J.R.
      Dietary bioactive lipid compounds rich in menthol alter interactions among members of ruminal microbiota in sheep.
      ).

      Detection of TRP Channels on mRNA Level

      After a feeding period of at least 4 wk, animals were slaughtered by exsanguination from the carotid arteries after stunning by captive bolt in accordance with German laws as described previously (
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ). Samples of ruminal papillae and of the jejunal mucosal layer (without submucosal tissue) were taken from each animal, placed in RNAlater solution (Sigma-Aldrich, Taufkirchen, Germany), stored at 4°C for 12 h and at −20°C thereafter. The Nucleospin RNA II kit was used for total RNA isolation (Macherey-Nagel Nucleospin RNA, Düren, Germany) as described previously (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ). Reverse transcription was carried out with 1,000 ng RNA using an iScript cDNA synthesis kit (Bio-Rad, Taufkirchen, Germany) according to the manufacturer's instructions. Reactions were subsequently diluted 1:10.
      For amplification steps of the reverse-transcription quantitative PCR, exon-transcending primers, and fluorescence-labeled probes with FAM as a reporter and TAMRA or BHQ as quencher were designed for TRPA1, TRPV3, TRPV5, and TRPM6 through TRPM8 (Table 1). The sequence of TRPV6 was obtained from
      • Wilkens M.R.
      • Kunert-Keil C.
      • Brinkmeier H.
      • Schröder B.
      Expression of calcium channel TRPV6 in ovine epithelial tissue.
      . Amplification products were sequenced by Microsynth Seqlab (Göttingen, Germany) and sequence specificity was verified by NCBI Blast database (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
      Table 1Forward (Fwd) and reverse (Rev) primer sequences, probe sequences, and expected amplicon length for transient receptor potential channels and reference genes
      GeneSenseSequence (5′→ 3′)Length (bp)
      TRPA1FwdGCGCATTATTTCTCAGTGACC135
      RevTGTTCCCTTCTTCATCTAGCC
      ProbeFAM_GCTGGACTGCTTTGCATCATGCTTCCTT_BHQ
      TRPV3FwdCTACAACACCAACATTGACAAC116
      RevAGCAGAAGGACAGGAAGAAC
      ProbeFAM_CACACGCTGCTGCATATGAAGTGGAAGA_BHQ
      TRPV5FwdGAGATCATTCGTCGCAACAC85
      RevACTGATAAACCCGATCCTCTC
      ProbeFAM_TGGGACACGTGAATCTCGGACTGGA_TAMRA
      TRPV6FwdTGATGGGAGACACTCACTGG96
      RevGCAGCTTCTTCTCCAGCATC
      ProbeFAM_TGGCTACAACCTGCGCCCT_TAMRA
      TRPM6FwdCACATTGGTCTCCTGCTTC142
      RevACTTTTCCACACACTGTTCTTC
      ProbeFAM_CAGCACCAAGCTCCAAATGACCAAGAA_BHQ
      TRPM7FwdTCAACAGGCAGGACCTTATG150
      RevGCAAGAGTCCAAGATGGTG
      ProbeFAM_GTTCCCAGAAAGGCAATACTTTATCCTCGT_BHQ
      TRPM8FwdACCCTGAGGTTGATTCACATT108
      RevGGCAAAGAGGAACAGGAAGA
      ProbeFAM_TGTTGCAGAGGATGCTGATCGACGTGTTCT_BHQ
      ACTBFwdGCCAACCGTGAGAAGATGAC124
      RevAGTCCATCACGATGCCAGTG
      ProbeFAM_CCAGATCATGTTTGAGACCTTCAACACCCCTGC_TAMRA
      GAPDHFwdAAGAAGGTGGTGAAGCAGGC144
      RevCTGTTGAAGTCGCAGGAGAC
      ProbeFAM_GGCATTCTAGGCTACACTGAGGACCAGGTTG_TAMRA
      YWHAZFwdAGAGAGAAAATAGAGACCGAGC89
      RevAGCCAAGTAGCGGTAGTAG
      ProbeFAM­_CCAACGCTTCACAAGCAGAGAGCAAA_TAMRA
      A 40-cycle 2-step reverse-transcription quantitative PCR was performed in triplicates on a ViiA7 thermocycler (Applied Biosystems/Life Technologies, Waltham, MA). An aliquot of 3.7 µL of cDNA was added to the master mix of primers, probe, and iTaq Universal Probes Supermix (Bio-Rad, Feldkirchen, Germany) in total assay volumes of 10 µL.
      Thresholds were set by the cycler software. The data analysis software qBasePLUS (Biogazelle NV, Zwijnaarde, Belgium) was used for inter-run calibration and to calculate dilution series-based gene-specific amplification efficiency. Reference genes ACTB, GAPDH, and YWHAZ were tested for their expression stability. Quantification cycle (Cq) values of the target genes were normalized with the reference genes that had the lowest geNorm expression stability value M (rumen, GAPDH and YWHAZ; jejunum, ACTB, GAPDH, and YWHAZ) as described earlier (
      • Vandesompele J.
      • De Preter K.
      • Pattyn F.
      • Poppe B.
      • Van Roy N.
      • De Paepe A.
      • Speleman F.
      Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.
      ) and scaled to the mean value of the Con group. The resulting calibrated normalized relative quantities were used for statistical analysis.

      Tissue Preparation for Ussing Chamber Experiments

      Immediately after slaughter, ruminal and intestinal tissue was obtained from the ventral sac (∼25 × 25 cm) and the middle of the jejunum (∼1.5 m length), respectively, and rinsed in 38°C NaCl solution (9 g/L). Epithelial tissues were stripped off the muscular layers and transported to the laboratory within 30 min in pre-warmed (38°C) transport solution (pH 7.4, 288 mOsm/L; see Table 2) gassed with carbogen (95% O2 and 5% CO2). Further details of the procedure are described in
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      .
      Table 2Chemical composition (mM), osmolarity, and pH of incubation solutions used for incubation during epithelial preparation, transport, and during Ussing chamber experiments
      Item
      MES = 2-(N-morpholino)ethanesulfonic acid; NMDG = N-methyl-d-glucamine.
      Serosal
      The serosal incubation solution was also used for epithelia preparation and transport.
      Rumen, mucosalJejunum, mucosal
      Na+-containingNa+-freeNa+-containingNa+-free
      CaCl21.81.81.81.81.8
      MgCl21.00000
      HEPES10001010
      MES0101000
      NaCl70700700
      HCl01787272
      Na-acetate025000
      Acetic acid002500
      Na-propionate010000
      Propionic acid001000
      Na-butyrate05000
      Butyric acid00500
      Na-gluconate4000400
      Gluconic acid000040
      NMDG, free base5201127117
      KH2PO40.40.40.40.40.4
      K2HPO42.42.42.42.42.4
      NaHCO325250250
      Choline-HCO30025025
      Enrofloxacin0.02780.02780.02780.02780.0278
      Mannitol0191999
      Glucose100000
      Osmolarity, mOsm/L288288288288288
      pH7.46.46.47.47.4
      1 MES = 2-(N-morpholino)ethanesulfonic acid; NMDG = N-methyl-d-glucamine.
      2 The serosal incubation solution was also used for epithelia preparation and transport.

      Ca2+ Flux Rates and Electrophysiological Measurements

      Ruminal and jejunal epithelia were mounted in Ussing chambers with an exposed area of 3.14 and 0.95 cm2, respectively. The chambers mounted with ruminal and jejunal epithelia contained 16 and 12 mL of incubation solution, respectively, on both sides (for composition, see Table 2). Serosal incubation solution was identical for ruminal and jejunal epithelia with pH adjusted to 7.4 and osmolarity adjusted to 288 mOsm/L. The mucosal incubation solution for ruminal epithelia had a pH 6.4 (288 mOsm/L) and contained 40 mmol/L of short-chain fatty acids (SCFA) because luminal SCFA had been shown previously to stimulate ruminal Ca2+ absorption (
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ). At variance, the mucosal incubation solution for jejunal epithelia had a pH of 7.4 (288 mOsm/L) and was devoid of SCFA. For half of the ruminal and jejunal epithelia, Na+ was replaced by N-methyl-d-glucamine (NMDG+) to create Na+-free mucosal incubation solutions. The absence of mucosal Na+ was intended to shut down H+ extrusion via the Na+/H+ exchanger (
      • Uppal S.K.
      • Wolf K.
      • Khahra S.S.
      • Martens H.
      Modulation of Na+ transport across isolated rumen epithelium by short-chain fatty acids in hay- and concentrate-fed sheep.
      ) and, hence, to stimulate Ca2+ absorption via a putative Ca2+/H+ exchanger (
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ). All mucosal incubation solutions were Mg2+-free to avoid interference of Mg2+ with Ca2+ transport proteins and ion channels.
      Mucosal and serosal solutions were circulated by a gas lift system operated with carbogen, and temperature was maintained at 38°C by temperature-controlled water jackets surrounding the incubation solution reservoirs. Tissue conductance (Gt) as a measure for passive ion permeability via transcellular and paracellular pathways and short-circuit current (Isc) as a measure for an active transcellular ion transport were continuously recorded as described previously (
      • Aschenbach J.R.
      • Wehning H.
      • Kurze M.
      • Schaberg E.
      • Nieper H.
      • Burckhardt G.
      • Gäbel G.
      Functional and molecular biological evidence of SGLT-1 in the ruminal epithelium of sheep.
      ) with the exception that clamp current application occurred with platinum electrodes inserted directly into the incubation solution. To determine Isc, all epithelia were switched from open to short-circuit mode ∼10 min after mounting.
      For every sheep, 8 Ussing chambers were used for ruminal and jejunal tissues each, which were again divided in 4 chambers with Na+-containing and 4 chambers with Na+-free mucosal incubation solution. Within each of those 4-chamber sets of Ussing chambers, 2 epithelia with similar tissue conductance (Gt) were paired to investigate Ca2+ flux rates in mucosal-to-serosal (Jms) and serosal-to-mucosal (Jsm) directions. Unidirectional Ca2+ flux rates were measured using 50 kBq and 70 kBq of 45Ca2+ as tracer in ruminal and jejunal epithelia, respectively. The 45Ca2+ tracer was added to either the mucosal (Jms) or the serosal (Jsm) side of the epithelium, which will be called the “hot” side hereafter. After equilibration for 50 min, flux measurements were performed over 3 consecutive flux periods (P1 through P3) by taking samples (600 µL) at 45-min intervals from the opposite (“cold”) side. The removed sample volume was immediately replaced by new incubation solution with identical composition. The specific activity of Ca2+ on the hot side was determined as mean of two 100-µL samples taken from the hot side at the start and end of flux measurements. Radioactivity was measured by β-counter (LKB Wallace-Perkin-Elmer, Überlingen, Germany) after volume correction of hot samples (to 600 µL) and the addition of 3 mL of liquid scintillation fluid (Aquasafe 300, Zinsser Analytic GmbH, Frankfurt, Germany) to all samples. Unidirectional flux rates (extrapolated to nmol·cm−2·h−1) were calculated by relating the rate of 45Ca2+ appearance on the cold side to the specific activity of the hot side (
      • Martens H.
      • Harmeyer J.
      Magnesium transport by isolated rumen epithelium of sheep.
      ). To determine net flux rates (Jnet), Jsm was subtracted from the corresponding Jms for each tissue pair.
      Menthol (50 µM) was added to the mucosal side of all epithelia immediately at the start of the second flux period (P2). After allowing for equilibration of flux rates and electrophysiology to menthol stimulation during period P2, the steady state values of flux rates and electrophysiology under menthol stimulation were measured in period P3. This procedure allowed discriminating between long-term adaptation of ruminal and intestinal epithelia to the menthol pre-feeding, measured in the initial flux period P1, and the acute effects of menthol addition on Ca2+ flux rates and electrophysiology in the differently pre-fed animals. The acute effects of menthol stimulation were determined by subtracting the baseline values of period P1 from the values under menthol stimulation determined in period P3, further referred to as ΔJms, ΔJsm, and ΔJnet for flux rates and ΔIsc and ΔGt for electrophysiological values.

      Statistical Analysis

      One outlier from the PBLC-L group was removed from all electrophysiological and flux data. Electrophysiological data (Gt and Isc) of each epithelium were pooled arithmetically over each flux period to compute the period means of P1 and P3. Electrophysiological and Ca2+ flux rate data were analyzed using the mixed model procedure of SAS version 8.02 (SAS Institute Inc., Cary, NC) in a 3 (PBLC dose; 0, 80, and 160 mg/d) × 2 (Na+; present or absent in mucosal solution) factorial arrangement. The model contained fixed effects of PBLC dose, Na+, interaction between PBLC dose × Na+, block, sex, and run and random effects of chamber within animal. The gene expression data were analyzed with the same mixed model procedure, but without Na+ and interaction between PBLC dose × Na+ in the model to compare only PBLC doses. Polynomial contrasts were used to identify linear and quadratic effects of PBLC doses (0, 80, and 160 mg/d). The overall effects of the pooled PBLC groups compared with the Con group were also determined (Con vs. PBLC). Variability of data was expressed as SEM. Statistical significance was set at P ≤ 0.05, and a trend was considered at 0.05 < P ≤ 0.10.

      RESULTS

      Quantitative RT-PCR

      In the rumen, mRNA expression of TRPV5, TRPV6, and TRPM8 was undetectable or too weak to be quantified. The mRNA for TRPA1, TRPV3, TRPM6, and TRPM7 was quantifiable in the order TRPV3TRPM6 > TRPM7 > TRPA1. The calibrated normalized relative quantities of these gene amplicons were not different among feeding groups (Figure 1).
      Figure thumbnail gr1
      Figure 1Calibrated normalized relative quantities (CNRQ) of mRNA expression of transient receptor potential channels in (A) ruminal and (B) jejunal epithelia in sheep pre-fed with menthol-rich plant bioactive lipid compounds (PBLC) at concentrations of 0 mg/d (Con), 80 mg/d (PBLC-L), or 160 mg/d (PBLC-H). P-values for linear and quadratic effects and Con versus pooled PBLC-L and PBLC-H groups (Con vs. PBLC) are indicated below each gene transcript. Data are LSM ± SEM of n = 8 sheep per group.
      In the jejunum, mRNA expression of TRPV3 and TRPM8 was undetectable or too weak to be quantified. The mRNA expression of the other TRP channels was quantifiable in the order TRPM7 > TRPA1TRPM6TRPV6 > TRPV5. Of these, menthol-rich PBLC pre-feeding decreased the mRNA expression of TRPA1 (Con vs. PBLC, P = 0.043) and TRPV5 (Con vs. PBLC, P = 0.027) when comparing the pooled PBLC feeding groups with Con. In addition, TRPV5 mRNA abundance decreased with increasing PBLC dose linearly (P = 0.010). A trend for a similar linear effect was detected for TRPA1 (P = 0.054) and TRPV6 (P = 0.062).

      Electrophysiological Data

      In the rumen, pre-feeding the menthol-rich PBLC did not affect baseline Gt in period P1, whereas baseline Isc increased quadratically with increasing PBLC dose (P = 0.039) and was higher in the pooled PBLC groups versus Con (P < 0.001). The omission of Na+ decreased Gt and Isc (P < 0.001; Table 3).
      Table 3Effect of menthol-rich plant bioactive lipid compound (PBLC) pre-feeding and mucosal Na+ availability on baseline tissue conductance (Gt) and short-circuit current (Isc), as well as changes of these electrophysiological data (ΔGt and ΔIsc) after mucosal menthol addition ex vivo to ruminal epithelia of sheep
      Item
      Gt and Isc represent baseline values from flux period P1; ΔGt and ΔIsc reflect changes of Gt and Isc between baseline values (period P1, 0–45 min) and values in the mucosal presence of 50 μM menthol (period P3, 90–135 min).
      FactorFactor PBLC dose
      PBLC fed at 0 mg/d (Con; n = 8), 80 mg/d (PBLC-L; n = 7), or 160 mg/d (PBLC-H; n = 8).
      LSM (Na+)
      LSM (Na+) represent LSM of all treatments (Con, PBLC-L, PBLC-H) under either Na+ or NMDG+ incubation; ± SEM.
      Contrast
      Na+ConPBLC-LPBLC-HLinearQuadraticCon vs. PBLC
      Con vs. PBLC = control versus pooled PBLC-L and PBLC-H groups.
      Na+PBLC × Na+
      Gt, mS·cm−2Na+3.803.743.943.83 ± 0.110.140.300.46<0.0010.76
      NMDG+2.732.723.112.85 ± 0.11
      LSM (PBLC)
      LSM (PBLC) represent LSM of both Na+ and N-methyl-d-glucamine (NMDG+) incubation within a PBLC dose; ± SEM.
      3.27 ± 0.123.23 ± 0.143.52 ± 0.13
      Isc, μEq·cm−2·h−1Na+12.320.021.017.8 ± 0.77<0.0010.039<0.001<0.0010.072
      NMDG+−11.4−9.24−8.91−9.85 ± 0.79
      LSM (PBLC)0.46 ± 1.135.39 ± 0.826.03 ± 0.84
      ΔGt, mS·cm−2Na+0.340.520.570.48 ± 0.040.0430.0650.011<0.0010.34
      NMDG+0.670.840.730.75 ± 0.04
      LSM (PBLC)0.51 ± 0.050.68 ± 0.050.65 ± 0.05
      ΔIsc, μEq·cm−2·h−1Na+−2.33
      P < 0.05 for individual means within each item.
      −2.91
      P < 0.05 for individual means within each item.
      0.36
      P < 0.05 for individual means within each item.
      −1.63 ± 0.31<0.0010.460.0150.14<0.001
      NMDG+−3.10
      P < 0.05 for individual means within each item.
      −1.41
      P < 0.05 for individual means within each item.
      −2.23
      P < 0.05 for individual means within each item.
      −2.25 ± 0.32
      LSM (PBLC)−2.71 ± 0.40−2.16 ± 0.40−0.94 ± 0.33
      a–c P < 0.05 for individual means within each item.
      1 Gt and Isc represent baseline values from flux period P1; ΔGt and ΔIsc reflect changes of Gt and Isc between baseline values (period P1, 0–45 min) and values in the mucosal presence of 50 μM menthol (period P3, 90–135 min).
      2 PBLC fed at 0 mg/d (Con; n = 8), 80 mg/d (PBLC-L; n = 7), or 160 mg/d (PBLC-H; n = 8).
      3 LSM (Na+) represent LSM of all treatments (Con, PBLC-L, PBLC-H) under either Na+ or NMDG+ incubation; ± SEM.
      4 Con vs. PBLC = control versus pooled PBLC-L and PBLC-H groups.
      5 LSM (PBLC) represent LSM of both Na+ and N-methyl-d-glucamine (NMDG+) incubation within a PBLC dose; ± SEM.
      Changes in tissue conductance (ΔGt; P = 0.043) and changes in short-circuit current (ΔIsc; P < 0.001) after direct menthol addition to the mucosal side increased in a linear manner with increasing PBLC dose. The responsiveness to acute menthol stimulation was also higher in the pooled PBLC groups compared with Con for ΔGt (Con vs. PBLC, P = 0.011) and ΔIsc (Con vs. PBLC, P = 0.015). The level of ΔGt was generally lower (P < 0.001) in the mucosal presence versus absence of Na+, indicating a lesser time-dependent increase in Gt (from P1 to P3) in the mucosal presence of Na+. A significant PBLC dose × Na+ interaction was observed for ΔIsc (P < 0.001) with lowest values for Con under Na+-free conditions and highest values for PBLC-H under Na+-containing conditions on the mucosal side (Table 3).
      In the jejunum, PBLC pre-feeding did not affect basal Isc and Gt values (Table 4). The omission of mucosal Na+ decreased baseline Gt and Isc in all groups (P < 0.001, each). Changes in Isc and Gt values after direct menthol application were not different among pre-feeding groups, with only a trend for higher ΔIsc in the PBLC pre-fed groups (Con vs. PBLC, P = 0.056). Time-dependent changes between P1 and P3 were more negative for ΔGt under Na+-containing conditions (P = 0.003) and more negative for ΔIsc under Na+-free conditions on the mucosal side (P < 0.001).
      Table 4Effect of menthol-rich plant bioactive lipid compound (PBLC) pre-feeding and mucosal Na+ availability on baseline tissue conductance (Gt) and short-circuit current (Isc), as well as changes of these electrophysiological data (ΔGt and ΔIsc) after mucosal menthol addition ex vivo to jejunal epithelia of sheep
      Item
      Gt and Isc represent baseline values from flux period P1; ΔGt and ΔIsc reflect changes of Gt and Isc between baseline values (period P1, 0–45 min) and values in the mucosal presence of 50 μM menthol (period P3, 90–135 min).
      FactorFactor PBLC dose
      PBLC fed at 0 mg/d (Con; n = 8), 80 mg/d (PBLC-L; n = 7), or 160 mg/d (PBLC-H; n = 8).
      LSM (Na+)
      LSM (Na+) represent LSM of all treatments (Con, PBLC-L, PBLC-H) under either Na+ or NMDG+ incubation; ± SEM.
      Contrast
      Na+ConPBLC-LPBLC-HLinearQuadraticCon vs. PBLC
      Con vs. PBLC = control versus pooled PBLC-L and PBLC-H groups.
      Na+PBLC × Na+
      Gt, mS·cm−2Na+17.016.116.116.4 ± 0.330.370.120.12<0.0010.73
      NMDG+10.89.7410.610.4 ± 0.33
      LSM (PBLC)
      LSM (PBLC) represent LSM of both Na+ and N-methyl-d-glucamine (NMDG+) incubation within a PBLC dose; ± SEM.
      13.9 ± 0.4012.9 ± 0.3913.4 ± 0.41
      Isc, μEq·cm−2·h−1Na+9.498.054.847.46 ± 1.630.720.320.91<0.0010.079
      NMDG+−12.9−14.7−6.05−11.2 ± 1.66
      LSM (PBLC)−1.69 ± 2.02−3.35 ± 1.680.60 ± 2.29
      ΔGt, mS·cm−2Na+−1.51−0.86−1.32−1.23 ± 0.260.300.390.190.0030.70
      NMDG+−0.55−0.0750.19−0.14 ± 0.26
      LSM (PBLC)−1.03 ± 0.32−0.47 ± 0.31−0.56 ± 0.33
      ΔIsc, μEq·cm−2·h−1Na+−0.372.592.771.66 ± 0.770.0790.200.056<0.0010.85
      NMDG+−8.01−5.81−6.33−6.72 ± 0.76
      LSM (PBLC)−4.19 ± 1.18−1.61 ± 0.84−1.78 ± 0.71
      1 Gt and Isc represent baseline values from flux period P1; ΔGt and ΔIsc reflect changes of Gt and Isc between baseline values (period P1, 0–45 min) and values in the mucosal presence of 50 μM menthol (period P3, 90–135 min).
      2 PBLC fed at 0 mg/d (Con; n = 8), 80 mg/d (PBLC-L; n = 7), or 160 mg/d (PBLC-H; n = 8).
      3 LSM (Na+) represent LSM of all treatments (Con, PBLC-L, PBLC-H) under either Na+ or NMDG+ incubation; ± SEM.
      4 Con vs. PBLC = control versus pooled PBLC-L and PBLC-H groups.
      5 LSM (PBLC) represent LSM of both Na+ and N-methyl-d-glucamine (NMDG+) incubation within a PBLC dose; ± SEM.

      Basal Ca2+ Flux Rates

      In the rumen, the basal Ca2+ flux rates measured in the initial flux period P1 were higher (P < 0.001) for Jms than for Jsm, resulting in a positive Jnet (Figure 2). The latter increased in a quadratic manner (P = 0.043) from 41.0 ± 1.82 nmol·cm−2·h−1 in Con to 46.7 ± 2.05 in PBLC-L and 39.5 ± 1.91 nmol·cm−2·h−1 in PBLC-H. The quadratic response of Jnet was largely mirroring a similar trend for a quadratic response in Jms (P = 0.067), whereas Jsm tended to increase linearly (P = 0.053). The replacement of mucosal Na+ by NMDG+ decreased the basal Jms and Jnet (P < 0.001, each) by approximately 30% in all feeding groups, whereas Jsm increased (P < 0.001; Figure 2).
      Figure thumbnail gr2
      Figure 2Effect of long-term menthol-rich plant bioactive lipid compound (PBLC) pre-feeding in a dose range of 0 mg/d (Con), 80 mg/d (PBLC-L), and 160 mg/d (PBLC-H) on baseline values in period P1 for (A) mucosal-to-serosal (Jms), (B) serosal-to-mucosal (Jsm), and (C) resulting net (Jnet) flux rates of Ca2+ in the presence (left) and absence (right) of mucosal Na+ (replaced by N-methyl-d-glucamine, NMDG+) in the rumen. Jms tended to increase in a quadratic manner (Q, P = 0.067), whereas Jsm tended to increase linearly (L, P = 0.053), resulting in a quadratic effect for Jnet (Q, P = 0.043). The omission of Na+ decreased Jms and Jnet, and increased Jsm at P < 0.001, each (***). P-values for linear (L) and quadratic effects (Q) and Con versus pooled PBLC-L and PBLC-H groups (Con vs. PBLC) are indicated for each graph. Data are given as LSM ± SEM of n = 8, 7, and 8 sheep in Con, PBLC-L, and PBLC-H, respectively.
      In the jejunum, Jms and Jsm did not differ statistically across feeding groups (Figure 3); hence, no significant Jnet could be calculated. Pre-feeding of PBLC or replacement of mucosal Na+ by NMDG+ did not affect any of the measured Ca2+ flux rates in the jejunum (Figure 3).
      Figure thumbnail gr3
      Figure 3Effect of long-term menthol-rich plant bioactive lipid compound (PBLC) pre-feeding) in a dose range of 0 mg/d (Con), 80 mg/d (PBLC-L), and 160 mg/d (PBLC-H) on baseline values in period P1 for (A) mucosal-to-serosal (Jms) and (B) serosal-to-mucosal (Jsm) flux rates of Ca2+ in the presence (left) and absence (right) of mucosal Na+ (replaced by N-methyl-d-glucamine, NMDG+) in the jejunum. Jms and Jsm did not differ statistically; hence, no significant Jnet could be calculated. Menthol-rich PBLC pre-feeding had no influence on Jms and Jsm fux rates. No significant effect of Na+ could be observed in the jejunum. P-values for linear (L) and quadratic effects (Q) and Con versus pooled PBLC-L and PBLC-H groups (Con vs. PBLC) are indicated for each graph. Data are given as LSM ± SEM of n = 8, 7, and 8 sheep in Con, PBLC-L, and PBLC-H, respectively.

      Acute Effects of Menthol on Ca2+ Flux Rates

      After direct menthol application on the mucosal side of the epithelium, we subtracted the Ca2+ flux rates after menthol (P3) addition from the baseline Ca2+ flux rates before menthol addition (P1) to detect changes of Ca2+ flux rates (ΔJ).
      In the rumen (Figure 4), menthol addition did not acutely affect ΔJsm but increased ΔJms flux rates linearly in all feeding groups (P = 0.008). This resulted in a linear increase of ΔJnet (P = 0.038). When comparing the pooled PBLC-L and PBLC-H feeding groups with the Con group, responsiveness of ΔJnet to menthol was higher in PBLC-prefed animals (Con vs. PBLC, P = 0.008). In line with the smaller increases in ΔGt mentioned earlier, ΔJsm were also smaller in the presence of mucosal Na+ (P = 0.002), most likely indicating smaller time-dependent increases in passive epithelial conductance to ions, including Ca2+, when mucosal Na+ is present. The ΔJms and ΔJnet were not affected by the omission of mucosal Na+.
      Figure thumbnail gr4
      Figure 4Acute effects of mucosal menthol application on ruminal epithelia of sheep pre-fed with menthol-rich plant bioactive lipid compounds (PBLC) in a dose range of 0 mg/d (Con), 80 mg/d (PBLC-L), and 160 mg/d (PBLC-H) with regard to changes of (A) mucosal-to-serosal (ΔJms), (B) serosal-to-mucosal (ΔJsm), and (C) resulting net (ΔJnet) flux rates of Ca2+ in the presence (left) and absence (right) of mucosal Na+ (replaced by N-methyl-d-glucamine, NMDG+). The PBLC pre-fed animals responded to acute menthol application with higher ΔJms stimulation than Con animals (Con vs. PBLC, P = 0.001), resulting also in a higher increase of ΔJnet for PBLC pre-fed animals (Con vs. PBLC, P = 0.008). The absence of mucosal Na+ did not affect ΔJms and ΔJnet, albeit ΔJsm increased at P = 0.002 (**). P-values for linear (L) and quadratic effects (Q) and Con versus pooled PBLC-L and PBLC-H groups (Con vs. PBLC) are indicated for each graph. Data were computed from the difference of values in period P3 minus values in period P1 and are presented as LSM ± SEM of n = 8, 7, and 8 sheep in Con, PBLC-L, and PBLC-H, respectively.
      In the jejunum, menthol-rich PBLC pre-feeding had no effect on changes of Ca2+ flux rates after direct menthol application (Figure 5). The omission of Na+ increased ΔJms (P = 0.025) and ΔJsm (P = 0.015) independent of PBLC pre-feeding.
      Figure thumbnail gr5
      Figure 5Acute effects of mucosal menthol application on jejunal epithelia of sheep pre-fed with menthol-rich plant bioactive lipid compounds (PBLC) in a dose range of 0 mg/d (Con), 80 mg/d (PBLC-L), and 160 mg/d (PBLC-H) with regard to changes of (A) mucosal-to-serosal (ΔJms) and (B) serosal-to-mucosal flux rates (ΔJsm) of Ca2+ in the presence (left) and absence (right) of mucosal Na+ (replaced by N-methyl-d-glucamine, NMDG+). Menthol-rich PBLC pre-feeding had no influence on ΔJms and ΔJsm flux rates. The omission of Na+ increased ΔJms (*P = 0.025) and ΔJsm (*P = 0.015). P-values for linear (L) and quadratic effects (Q) and Con versus pooled PBLC-L and PBLC-H groups (Con vs. PBLC) are indicated for each graph. Data were computed from the difference of values in period P3 minus values in period P1 and are presented as LSM ± SEM of n = 8, 7, and 8 sheep in Con, PBLC-L, and PBLC-H, respectively.

      DISCUSSION

      After the onset of lactation, the Ca2+ demand of high-yielding dairy cows increases abruptly from ∼80 to 500 mg·kg−0.75 (
      • Horst R.L.
      • Goff J.P.
      • Reinhardt T.A.
      Adapting to the transition between gestation and lactation: differences between rat, human and dairy cow.
      ), which leads to a high incidence of hypocalcemia (
      • Reinhardt T.A.
      • Lippolis J.D.
      • McCluskey B.J.
      • Goff J.P.
      • Horst R.L.
      Prevalence of subclinical hypocalcemia in dairy herds.
      ;
      • Martinez N.
      • Risco C.A.
      • Lima F.S.
      • Bisinotto R.S.
      • Greco L.F.
      • Ribeiro E.S.
      • Maunsell F.
      • Galvao K.
      • Santos J.E.
      Evaluation of peripartal calcium status, energetic profile, and neutrophil function in dairy cows at low or high risk of developing uterine disease.
      ;
      • Venjakob P.L.
      • Borchardt S.
      • Heuwieser W.
      Hypocalcemia-Cow-level prevalence and preventive strategies in German dairy herds.
      ). Hypocalcemia results from delayed and partially insufficient activation of endogenous Ca2+-homeostatic mechanisms, which are the release of Ca2+ from internal stores (e.g., bones) and an enforcement of gastrointestinal Ca2+ absorption (
      • Reinhardt T.A.
      • Horst R.L.
      • Goff J.P.
      Calcium, phosphorus, and magnesium homeostasis in ruminants.
      ;
      • Horst R.L.
      • Goff J.P.
      • Reinhardt T.A.
      Adapting to the transition between gestation and lactation: differences between rat, human and dairy cow.
      ). Because already subclinical reductions of serum Ca2+ concentration have negative consequences for performance and health (
      • Chapinal N.
      • Carson M.E.
      • LeBlanc S.J.
      • Leslie K.E.
      • Godden S.
      • Capel M.
      • Santos J.E.
      • Overton M.W.
      • Duffield T.F.
      The association of serum metabolites in the transition period with milk production and early-lactation reproductive performance.
      ;
      • Venjakob P.L.
      • Pieper L.
      • Heuwieser W.
      • Borchardt S.
      Association of postpartum hypocalcemia with early-lactation milk yield, reproductive performance, and culling in dairy cows.
      ), an effective support of Ca2+-homeostatic mechanisms by management strategies is of utmost importance. One such strategy can be to take advantage of the Ca2+-absorptive capacity of the rumen (
      • Schröder B.
      • Breves G.
      Mechanisms and regulation of calcium absorption from the gastrointestinal tract in pigs and ruminants: comparative aspects with special emphasis on hypocalcemia in dairy cows.
      ;
      • Hyde M.L.
      • Wilkens M.R.
      • Fraser D.R.
      In vivo measurement of strontium absorption from the rumen of dairy cows as an index of calcium absorption capacity.
      ), which can apparently be increased by dietary provision of PBLC (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ). Because a menthol-rich PBLC improved serum Ca2+ concentration in dairy cows (
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ) and sheep (
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ) in previous studies, the main aim of the present study was to identify the mechanisms behind it. In the present report, we demonstrate that these previous findings can be explained mainly by long-term sensitization of Ca2+ absorption to acute stimulation by menthol solely in the rumen, which was not accompanied by altered mRNA expression of ruminal TRP ion channels. The study further extended our general knowledge on Ca2+ transport mechanisms in the ruminant forestomach and small intestine and expanded the current knowledge on hypocalcemia prevention measures (
      • Wilkens M.R.
      • Nelson C.D.
      • Hernandez L.L.
      • McArt J.A.A.
      Symposium review: Transition cow calcium homeostasis—Health effects of hypocalcemia and strategies for prevention.
      ).

      Ca2+ Transport in the Rumen

      The Ca2+ flux data of the present study showed much greater Jms than Jsm, indicating a high capacity for active transcellular absorption of Ca2+ from the rumen. This is in line with various studies on ruminal Ca2+ transport (
      • Schröder B.
      • Vossing S.
      • Breves G.
      In vitro studies on active calcium absorption from ovine rumen.
      ;
      • Leonhard-Marek S.
      • Becker G.
      • Breves G.
      • Schröder B.
      Chloride, gluconate, sulfate, and short-chain fatty acids affect calcium flux rates across the sheep forestomach epithelium.
      ;
      • Wilkens M.R.
      • Praechter C.
      • Breves G.
      • Schröder B.
      Stimulating effects of a diet negative in dietary cation-anion difference on calcium absorption from the rumen in sheep.
      ;
      • Klinger S.
      • Schröder B.
      • Gemmer A.
      • Reimers J.
      • Breves G.
      • Herrmann J.
      • Wilkens M.R.
      Gastrointestinal transport of calcium and glucose in lactating ewes.
      ;
      • Nemeth M.V.
      • Wilkens M.R.
      • Liesegang A.
      Vitamin D status in growing dairy goats and sheep: Influence of ultraviolet B radiation on bone metabolism and calcium homeostasis.
      ) and emphasizes the importance of the forestomach segment for Ca2+ absorption (
      • Schröder B.
      • Breves G.
      Mechanisms and regulation of calcium absorption from the gastrointestinal tract in pigs and ruminants: comparative aspects with special emphasis on hypocalcemia in dairy cows.
      ;
      • Wilkens M.R.
      • Muscher-Banse A.S.
      Review: Regulation of gastrointestinal and renal transport of calcium and phosphorus in ruminants.
      ).
      A Ca2+/H+ exchanger of unknown molecular identity has been postulated as a key apical entry mechanism for Ca2+ in the ruminal epithelium because Ca2+ absorption is highly responsive to the luminal presence of SCFA (
      • Schröder B.
      • Vossing S.
      • Breves G.
      In vitro studies on active calcium absorption from ovine rumen.
      ,
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ;
      • Uppal S.K.
      • Wolf K.
      • Martens H.
      The effect of short chain fatty acids on calcium flux rates across isolated rumen epithelium of hay-fed and concentrate-fed sheep.
      ). The entry of protonated SCFA into ruminal epithelial cells is thought to provide the H+ driving force for the putative Ca2+/H+ exchanger due to acidification of the intracellular space (
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ). A similar explanation is established for the stimulation of ruminal Na+ absorption by the apical Na+/H+ exchanger of the ruminal epithelium, which has been identified as NHE3 on the molecular level (
      • Rabbani I.
      • Siegling-Vlitakis C.
      • Noci B.
      • Martens H.
      Evidence for NHE3-mediated Na transport in sheep and bovine forestomach.
      ). However, if apical Ca2+/H+ exchange and Na+/H+ exchange were really stimulated in parallel by SCFA via intracellular acidification, an omission of Na+ from the mucosal SCFA-containing solution should shut down H+ extrusion via NHE3 and thereby stimulate H+ extrusion via the putative Ca2+/H+ exchanger, resulting in elevated Jms and Jnet of Ca2+. By sharp contrast, we observed a decrease in Jms and Jnet after replacing Na+ with NMDG+ in the mucosal solution. The latter calls into question the functional involvement of a Ca2+/H+ exchange mechanism in ruminal Ca2+ transport.
      Nonselective cation channels provide an accepted alternative for the apical entry mechanism of Ca2+ into the ruminal epithelium (
      • Leonhard-Marek S.
      • Stumpff F.
      • Martens H.
      Transport of cations and anions across forestomach epithelia: conclusions from in vitro studies.
      ;
      • Wilkens M.R.
      • Muscher-Banse A.S.
      Review: Regulation of gastrointestinal and renal transport of calcium and phosphorus in ruminants.
      ). They have been functionally identified as members of the TRP family based on the responsiveness of ruminal Ca2+ currents or flux rates to stimulation by menthol and few other PBLC (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ;
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ). In the present study, application of 50 µM menthol also stimulated transepithelial Jms and Jnet of Ca2+, thus supporting the concept of TRP-mediated Ca2+ absorption from the rumen. As many of these TRP channels are also conductive for Na+ (
      • Owsianik G.
      • Talavera K.
      • Voets T.
      • Nilius B.
      Permeation and selectivity of TRP channels.
      ), replacement of Na+ by NMDG+ expectedly reduced the transepithelial current and conductance of ruminal epithelia.
      The menthol-sensitive Ca2+-conducting TRPM8 was not detectable in ruminal tissue on the mRNA level in the present study on the ovine rumen, as well as in a previous study on the bovine and ovine rumen (
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ). Therefore, it seems unlikely that TRPM8 is directly involved in ruminal Ca2+ transport, albeit it may have a role in mechano-sensory transduction, nociception, and inflammation in the gastrointestinal tract (
      • Ramachandran R.
      • Hyun E.
      • Zhao L.N.
      • Lapointe T.K.
      • Chapman K.
      • Hirota C.L.
      • Ghosh S.
      • McKemy D.D.
      • Vergnolle N.
      • Beck P.L.
      • Altier C.
      • Hollenberg M.D.
      TRPM8 activation attenuates inflammatory responses in mouse models of colitis.
      ;
      • Hosoya T.
      • Matsumoto K.
      • Tashima K.
      • Nakamura H.
      • Fujino H.
      • Murayama T.
      • Horie S.
      TRPM8 has a key role in experimental colitis-induced visceral hyperalgesia in mice.
      ;
      • Yu X.
      • Yu M.
      • Liu Y.
      • Yu S.
      TRP channel functions in the gastrointestinal tract.
      ). Similarly, our results exclude a role of TRPV5 and TRPV6 in ruminal Ca2+ transport. Their mRNA was not detected in the present study, which confirmed earlier studies showing no or weak mRNA abundance of TRPV5 and TRPV6 in ruminal epithelia of sheep, goat, and cattle (
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ,
      • Wilkens M.R.
      • Richter J.
      • Fraser D.R.
      • Liesegang A.
      • Breves G.
      • Schröder B.
      In contrast to sheep, goats adapt to dietary calcium restriction by increasing intestinal absorption of calcium.
      ;
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ), as well as extremely low TRPV6 (
      • Wilkens M.R.
      • Kunert-Keil C.
      • Brinkmeier H.
      • Schröder B.
      Expression of calcium channel TRPV6 in ovine epithelial tissue.
      ) or absent TRPV5 and TRPV6 protein in ovine rumen (
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ).
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      suggested TRPV3 as the potential candidate for menthol-stimulated Ca2+ transport in ruminal epithelial cells. In the present study, we detected mRNA signals for the Ca2+ conductive TRPV3 and TRPA1 in the ruminal epithelium, which are both known to be stimulated by PBLC such as menthol (
      • Karashima Y.
      • Damann N.
      • Prenen J.
      • Talavera K.
      • Segal A.
      • Voets T.
      • Nilius B.
      Bimodal action of menthol on the transient receptor potential channel TRPA1.
      ;
      • Vogt-Eisele A.K.
      • Weber K.
      • Sherkheli M.A.
      • Vielhaber G.
      • Panten J.
      • Gisselmann G.
      • Hatt H.
      Monoterpenoid agonists of TRPV3.
      ). Of these, TRPV3 had the strongest mRNA expression among all investigated TRP channels. Furthermore, a recent study identified appreciable TRPV3 protein expression in the bovine ruminal epithelium (
      • Liebe F.
      • Liebe H.
      • Kaessmeyer S.
      • Sponder G.
      • Stumpff F.
      The TRPV3 channel of the bovine rumen: localization and functional characterization of a protein relevant for ruminal ammonia transport.
      ). Intracellular acidification is known to activate TRPV3 (
      • Cao X.
      • Yang F.
      • Zheng J.
      • Wang K.
      Intracellular proton-mediated activation of TRPV3 channels accounts for the exfoliation effect of alpha-hydroxyl acids on keratinocytes.
      ), which could explain the stimulatory effect of SCFA on Ca2+ flux rates without postulation of a Ca2+/H+ exchanger. Because TRPV3 channel currents are inhibited by NMDG+ (
      • Schrapers K.T.
      • Sponder G.
      • Liebe F.
      • Liebe H.
      • Stumpff F.
      The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+.
      ), the postulation of TRPV3 as the major apical influx mechanism for Ca2+ could also explain the decreased Jms and Jnet of Ca2+ observed after replacing Na+ by NMDG+ in the present study.
      A final argument for a major involvement of TRPV3 in ruminal Ca2+ absorption is the finding that Jms and Jnet were notably higher in the present study compared with all previous studies (
      • Schröder B.
      • Goebel W.
      • Huber K.
      • Breves G.
      No effect of vitamin D3 treatment on active calcium absorption across ruminal epithelium of sheep.
      ;
      • Wilkens M.R.
      • Praechter C.
      • Breves G.
      • Schröder B.
      Stimulating effects of a diet negative in dietary cation-anion difference on calcium absorption from the rumen in sheep.
      ;
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      ;
      • Nemeth M.V.
      • Wilkens M.R.
      • Liesegang A.
      Vitamin D status in growing dairy goats and sheep: Influence of ultraviolet B radiation on bone metabolism and calcium homeostasis.
      ). The key difference to those previous studies is that we omitted Mg2+ from all mucosal incubation solutions. It is well established that Ca2+ currents via TRPV3 can be inhibited by Mg2+ due to interferences in the pore region (
      • Schrapers K.T.
      • Sponder G.
      • Liebe F.
      • Liebe H.
      • Stumpff F.
      The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+.
      ). Therefore, a higher Ca2+ absorption in the absence of Mg2+ ions is highly suggestive of TRP-mediated permeation. Admittedly, the lowering of mucosal pH to 6.4 (instead of pH 7.4) should also contribute to high Jms and Jnet due to an increased proportion of ionized Ca2+. However, a mucosal pH value of 6.4 had already been used in the previous study of
      • Rosendahl J.
      • Braun H.S.
      • Schrapers K.T.
      • Martens H.
      • Stumpff F.
      Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
      , with similar Jsm but much smaller Jms and Jnet compared with the present study. The latter underlines that avoidance of Mg2+ blockage of TRPV3 by omission of mucosal Mg2+ is the most suitable explanation for the very high Jms and Jnet in the present study.
      Collectively, our results together with previous findings provide several lines of indirect support for a major role for TPRV3 in Ca2+ absorption from rumen and its stimulation by menthol, although an additional involvement of TRPA1 seems possible. As an adjunct finding, we also identified ruminal expressions of TRPM6 and TRPM7, which apparently play a central role in ruminal Mg2+ transport (
      • Schweigel M.
      • Kolisek M.
      • Nikolic Z.
      • Kuzinski J.
      Expression and functional activity of the Na/Mg exchanger, TRPM7 and MagT1 are changed to regulate Mg homeostasis and transport in rumen epithelial cells.
      ;
      • Holzer P.
      TRP channels in the digestive system.
      ;
      • Martens H.
      • Leonhard-Marek S.
      • Rontgen M.
      • Stumpff F.
      Magnesium homeostasis in cattle: Absorption and excretion.
      ).

      Long-Term Effect of Menthol-Rich PBLC on Ruminal Ca2+ Transport

      Pre-feeding of menthol-rich PBLC increased baseline Isc in the rumen quadratically with increasing PBLC dose. A similar finding was reported in a previous study (
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ). An increasing Isc suggests either enhanced cation absorption or enhanced anion secretion, which is essentially active and transcellular. Results could thus fit to an increased opening of TRP cation channels with subsequently increased cation absorption (
      • Xu H.X.
      • Ramsey I.S.
      • Kotecha S.A.
      • Moran M.M.
      • Chong J.H.A.
      • Lawson D.
      • Ge P.
      • Lilly J.
      • Silos-Santiago I.
      • Xie Y.
      • DiStefano P.S.
      • Curtis R.
      • Clapham D.E.
      TRPV3 is a calcium-permeable temperature-sensitive cation channel.
      ;
      • Schrapers K.T.
      • Sponder G.
      • Liebe F.
      • Liebe H.
      • Stumpff F.
      The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+.
      ). Analyses of mRNA expression revealed no influence of PBLC dose on the expression of all investigated TRP channels in the ruminal epithelium. This does not preclude an altered expression of TRP proteins because discordances between mRNA and protein expression are sometimes noted (
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ;
      • Cheng Z.
      • Teo G.
      • Krueger S.
      • Rock T.M.
      • Koh H.W.
      • Choi H.
      • Vogel C.
      Differential dynamics of the mammalian mRNA and protein expression response to misfolding stress.
      ;
      • Greco G.
      • Hagen F.
      • Meissner S.
      • Shen Z.
      • Lu Z.
      • Amasheh S.
      • Aschenbach J.R.
      Effect of individual SCFA on the epithelial barrier of sheep rumen under physiological and acidotic luminal pH conditions.
      ). Alternatively, it could suggest that permanent exposure of the ruminal epithelium to agonists such as menthol could lead to more prominent translocation of TRP channels into the apical membrane or sustained stimulation (or both), with or without affecting their expressions. The quadratic increase in Isc with increasing PBLC concentrations was paralleled by a trend for a quadratic increase of Jms and a quadratic increase of Jnet, further supporting an increased basal TRP channel activity after 4 wk of PBLC pre-feeding. The magnitude of this increase, however, was so small that it may not quantitatively explain the increase in serum Ca2+ level in sheep (
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ) or cattle (
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ) pre-fed with menthol-rich PBLC.
      Strikingly, menthol pre-fed individuals reacted with higher increases in tissue conductivity (ΔGt) and lesser time-dependent decreases in short-circuit currents (ΔIsc) after direct menthol application in the Ussing chamber. An increase in tissue conductivity accompanied by higher short-circuit currents, the latter being essentially transcellular, support an increased ion channel opening after menthol application and fit increased channel-mediated cation absorption. This linearly links to the finding of increased absorptive Ca2+ flux rates (ΔJms and ΔJnet) after direct menthol application in the Ussing chambers. Absorptive Ca2+ flux rates were almost doubled in both groups pre-fed with PBLC. This strongly suggests that an increased responsiveness of ruminal Ca2+ absorption to menthol stimulation is the main mechanism by which prolonged PBLC pre-feeding increases Ca2+ supply to the blood. It will have to be elucidated in further studies whether this increased responsiveness of ruminal Ca2+ absorption to acute menthol stimulation is based on increased TRP protein translation, increased integration of translated TRP channels into the apical membrane, more sustained stimulation of the TRP channel population in the apical membrane, or any combination of these possibilities.

      Jejunal Ca2+ Transport

      In jejunum, we detected no significant net transport of Ca2+ in any of the feeding groups. The latter agrees with 2 previous studies (
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ;
      • Klinger S.
      • Schröder B.
      • Gemmer A.
      • Reimers J.
      • Breves G.
      • Herrmann J.
      • Wilkens M.R.
      Gastrointestinal transport of calcium and glucose in lactating ewes.
      ), although net absorption of Ca2+ across the jejunum is possible (
      • Schröder B.
      • Rittmann I.
      • Pfeffer E.
      • Breves G.
      In vitro studies on calcium absorption from the gastrointestinal tract in small ruminants.
      ), with lactation being one triggering factor (
      • Klinger S.
      • Schröder B.
      • Gemmer A.
      • Reimers J.
      • Breves G.
      • Herrmann J.
      • Wilkens M.R.
      Gastrointestinal transport of calcium and glucose in lactating ewes.
      ).
      We chose jejunum as a representative intestinal segment because jejunum appears to be most important for Ca2+ absorption among all intestinal segments of ruminants (
      • Wilkens M.R.
      • Kunert-Keil C.
      • Brinkmeier H.
      • Schröder B.
      Expression of calcium channel TRPV6 in ovine epithelial tissue.
      ). The latter postulate is partly based on the stimulation of jejunal Ca2+ net fluxes by calcitriol and lactation (
      • Schröder B.
      • Rittmann I.
      • Pfeffer E.
      • Breves G.
      In vitro studies on calcium absorption from the gastrointestinal tract in small ruminants.
      ;
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ;
      • Klinger S.
      • Schröder B.
      • Gemmer A.
      • Reimers J.
      • Breves G.
      • Herrmann J.
      • Wilkens M.R.
      Gastrointestinal transport of calcium and glucose in lactating ewes.
      ). Calcitriol, in turn, affects several steps of transcellular Ca2+ absorption, including apical entry via TRPV5 and TRPV6 (
      • Diaz de Barboza G.
      • Guizzardi S.
      • Tolosa de Talamoni N.
      Molecular aspects of intestinal calcium absorption.
      ;
      • Christakos S.
      • Dhawan P.
      • Verstuyf A.
      • Verlinden L.
      • Carmeliet G.
      Vitamin D: Metabolism, molecular mechanism of action, and pleiotropic effects.
      ). These TRP channels have been detected in the small intestine of ruminants (
      • Wilkens M.R.
      • Mrochen N.
      • Breves G.
      • Schröder B.
      Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
      ,
      • Wilkens M.R.
      • Richter J.
      • Fraser D.R.
      • Liesegang A.
      • Breves G.
      • Schröder B.
      In contrast to sheep, goats adapt to dietary calcium restriction by increasing intestinal absorption of calcium.
      ;
      • Schröder B.
      • Wilkens M.R.
      • Ricken G.E.
      • Leonhard-Marek S.
      • Fraser D.R.
      • Breves G.
      Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
      ), including the present study. By contrast, we detected no signals for the menthol-sensitive channels TRPV3 and TRPM8 on the mRNA level in jejunum. The mRNA of menthol-sensitive TRPA1 was expressed. However, menthol did not affect electrophysiological properties and jejunal Ca2+ flux rates, thereby calling into question the functional significance of TRPA1 in the jejunum of our animals. Moreover, the functional significance of TRPV5 and TRPV6 is equally questionable under the experimental conditions applied because no net Ca2+ transport from the mucosal to the serosal side was observed.
      Pre-feeding the menthol-rich PBLC tended to decrease the mRNA expression of TRPA1, TRPV5, and TRPV6 linearly, with lower mRNA expression of TRPA1 and TRPV5 in the pooled PBLC groups versus Con. Given the fact that these channels did not functionally trigger any net flux of Ca2+ under control conditions, their downregulation after PBLC pre-feeding also appears functionally not important. Teleologically, however, such downregulation makes sense. Because pre-feeding of menthol-rich PBLC tends to increase Ca2+ serum levels in sheep and increases Ca2+ levels in cows (
      • Braun H.S.
      • Schrapers K.T.
      • Mahlkow-Nerge K.
      • Stumpff F.
      • Rosendahl J.
      Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
      ;
      • Patra A.K.
      • Geiger S.
      • Schrapers K.T.
      • Braun H.S.
      • Gehlen H.
      • Starke A.
      • Pieper R.
      • Cieslak A.
      • Szumacher-Strabel M.
      • Aschenbach J.R.
      Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
      ), a surplus of Ca2+ in PBLC pre-fed sheep should lead to reduced activation of vitamin D3. This may, in turn, lower the expression of, at least, TRPV5 and TRPV6 because their expressions are under control of vitamin D3 and its metabolites (
      • van de Graaf S.F.
      • Boullart I.
      • Hoenderop J.G.
      • Bindels R.J.
      Regulation of the epithelial Ca2+ channels TRPV5 and TRPV6 by 1α,25-dihydroxy Vitamin D3 and dietary Ca2+.
      ;
      • Wilkens M.R.
      • Richter J.
      • Fraser D.R.
      • Liesegang A.
      • Breves G.
      • Schröder B.
      In contrast to sheep, goats adapt to dietary calcium restriction by increasing intestinal absorption of calcium.
      ;
      • Na T.
      • Peng J.B.
      TRPV5: A Ca2+ channel for the fine-tuning of Ca2+ reabsorption.
      ).

      CONCLUSIONS

      The present study substantiated a major role of the rumen in active transcellular absorption of Ca2+. The involvement of a previously suggested Ca2+/H+ exchanger for apical Ca2+ entry is challenged, because the replacement of mucosal Na+ did not stimulate but decreased Ca2+ absorption in ruminal epithelia. Alternatively, TRP channels allow apical Ca2+ entry and, hence, transcellular absorption in the rumen. Among these, a dominant role of TRPV3 is suggested from several lines of indirect evidence, including its strong mRNA expression, sustained stimulation of Ca2+ flux rates by menthol and low pH, as well as their inhibition by NMDG+ and Mg2+. Pre-feeding a menthol-rich PBLC for several weeks had no effects on the mRNA expression of ruminal TRP channels. Nonetheless, baseline Ca2+ absorption increased and, most importantly, the acute responsiveness of ruminal epithelia to menthol stimulation almost doubled. This unique finding provides a rationale to use menthol-containing feed additives as a prophylactic strategy to prevent hypocalcemia in dairy cows. Future studies will need to fine-tune this strategy for dairy cows and prove the clinical effectiveness in the transition phase, taking into account the possibility of concurrent suppression of calcitriol-sensitive absorption pathways in the jejunum (e.g., TRPV5 and TRPV6).

      ACKNOWLEDGMENTS

      We acknowledge the financial support of this project from Alexander von Humboldt-Stiftung, Bonn, Germany (to A.K.P. and J.R.A.), PerfomaNat GmbH, Berlin, Germany (to J.R.A.), and an Elsa Neumann stipend of the State of Berlin, Germany (to S.G.). We gratefully thank the barn staff of the animal facility of the Freie Universität Berlin, as well as J. N. Schulte, M. Grunau, and K. Soellig (all from Freie Universität Berlin, Germany) for their assistance, and F. Stumpff (Freie Universität Berlin, Germany) for expert discussions on this experiment. K.T.S and H.S.B. are or were employed by PerformaNat GmbH. J.R.A. is co-author of patent WO2014020067A1 that relates to the subject of the study. These facts did not affect the collection and interpretation of data. Other authors have no conflict of interest.

      REFERENCES

        • Aschenbach J.R.
        • Wehning H.
        • Kurze M.
        • Schaberg E.
        • Nieper H.
        • Burckhardt G.
        • Gäbel G.
        Functional and molecular biological evidence of SGLT-1 in the ruminal epithelium of sheep.
        Am. J. Physiol. Gastrointest. Liver Physiol. 2000; 279 (10898743): G20-G27
        • Braun H.S.
        • Schrapers K.T.
        • Mahlkow-Nerge K.
        • Stumpff F.
        • Rosendahl J.
        Dietary supplementation of essential oils in dairy cows: Evidence for stimulatory effects on nutrient absorption.
        Animal. 2019; 13 (30025546): 518-523
        • Cao X.
        • Yang F.
        • Zheng J.
        • Wang K.
        Intracellular proton-mediated activation of TRPV3 channels accounts for the exfoliation effect of alpha-hydroxyl acids on keratinocytes.
        J. Biol. Chem. 2012; 287 (22679014): 25905-25916
        • Chapinal N.
        • Carson M.
        • Duffield T.F.
        • Capel M.
        • Godden S.
        • Overton M.
        • Santos J.E.
        • LeBlanc S.J.
        The association of serum metabolites with clinical disease during the transition period.
        J. Dairy Sci. 2011; 94 (21943741): 4897-4903
        • Chapinal N.
        • Carson M.E.
        • LeBlanc S.J.
        • Leslie K.E.
        • Godden S.
        • Capel M.
        • Santos J.E.
        • Overton M.W.
        • Duffield T.F.
        The association of serum metabolites in the transition period with milk production and early-lactation reproductive performance.
        J. Dairy Sci. 2012; 95 (22365212): 1301-1309
        • Cheng Z.
        • Teo G.
        • Krueger S.
        • Rock T.M.
        • Koh H.W.
        • Choi H.
        • Vogel C.
        Differential dynamics of the mammalian mRNA and protein expression response to misfolding stress.
        Mol. Syst. Biol. 2016; 12 (26792871): 855
        • Christakos S.
        • Dhawan P.
        • Verstuyf A.
        • Verlinden L.
        • Carmeliet G.
        Vitamin D: Metabolism, molecular mechanism of action, and pleiotropic effects.
        Physiol. Rev. 2016; 96 (26681795): 365-408
        • Diaz de Barboza G.
        • Guizzardi S.
        • Tolosa de Talamoni N.
        Molecular aspects of intestinal calcium absorption.
        World J. Gastroenterol. 2015; 21 (26109800): 7142-7154
        • Goff J.P.
        The monitoring, prevention, and treatment of milk fever and subclinical hypocalcemia in dairy cows.
        Vet. J. 2008; 176 (18342555): 50-57
        • Greco G.
        • Hagen F.
        • Meissner S.
        • Shen Z.
        • Lu Z.
        • Amasheh S.
        • Aschenbach J.R.
        Effect of individual SCFA on the epithelial barrier of sheep rumen under physiological and acidotic luminal pH conditions.
        J. Anim. Sci. 2018; 96 (29378000): 126-142
        • Holzer P.
        TRP channels in the digestive system.
        Curr. Pharm. Biotechnol. 2011; 12 (20932260): 24-34
        • Horst R.L.
        • Goff J.P.
        • Reinhardt T.A.
        Adapting to the transition between gestation and lactation: differences between rat, human and dairy cow.
        J. Mammary Gland Biol. Neoplasia. 2005; 10 (16025221): 141-156
        • Hosoya T.
        • Matsumoto K.
        • Tashima K.
        • Nakamura H.
        • Fujino H.
        • Murayama T.
        • Horie S.
        TRPM8 has a key role in experimental colitis-induced visceral hyperalgesia in mice.
        Neurogastroenterol. Motil. 2014; 26 (24832648): 1112-1121
        • Houe H.
        • Ostergaard S.
        • Thilsing-Hansen T.
        • Jorgensen R.J.
        • Larsen T.
        • Sorensen J.T.
        • Agger J.F.
        • Blom J.Y.
        Milk fever and subclinical hypocalcaemia - An evaluation of parameters on incidence risk, diagnosis, risk factors and biological effects as input for a decision support system for disease control.
        Acta Vet. Scand. 2001; 42 (11455889): 1-29
        • Hyde M.L.
        • Wilkens M.R.
        • Fraser D.R.
        In vivo measurement of strontium absorption from the rumen of dairy cows as an index of calcium absorption capacity.
        J. Dairy Sci. 2019; 102 (31005315): 5699-5705
        • Karashima Y.
        • Damann N.
        • Prenen J.
        • Talavera K.
        • Segal A.
        • Voets T.
        • Nilius B.
        Bimodal action of menthol on the transient receptor potential channel TRPA1.
        J. Neurosci. 2007; 27 (17855602): 9874-9884
        • Kimura K.
        • Reinhardt T.A.
        • Goff J.P.
        Parturition and hypocalcemia blunts calcium signals in immune cells of dairy cattle.
        J. Dairy Sci. 2006; 89 (16772578): 2588-2595
        • Klinger S.
        • Schröder B.
        • Gemmer A.
        • Reimers J.
        • Breves G.
        • Herrmann J.
        • Wilkens M.R.
        Gastrointestinal transport of calcium and glucose in lactating ewes.
        Physiol. Rep. 2016; 4 (27273883)e12817
        • Leonhard-Marek S.
        • Becker G.
        • Breves G.
        • Schröder B.
        Chloride, gluconate, sulfate, and short-chain fatty acids affect calcium flux rates across the sheep forestomach epithelium.
        J. Dairy Sci. 2007; 90 (17297125): 1516-1526
        • Leonhard-Marek S.
        • Stumpff F.
        • Martens H.
        Transport of cations and anions across forestomach epithelia: conclusions from in vitro studies.
        Animal. 2010; 4 (22444608): 1037-1056
        • Liebe F.
        • Liebe H.
        • Kaessmeyer S.
        • Sponder G.
        • Stumpff F.
        The TRPV3 channel of the bovine rumen: localization and functional characterization of a protein relevant for ruminal ammonia transport.
        Pflugers Arch. 2020; 472 (32458085): 693-710
        • Macpherson L.J.
        • Hwang S.W.
        • Miyamoto T.
        • Dubin A.E.
        • Patapoutian A.
        • Story G.M.
        More than cool: Promiscuous relationships of menthol and other sensory compounds.
        Mol. Cell. Neurosci. 2006; 32 (16829128): 335-343
        • Martens H.
        • Harmeyer J.
        Magnesium transport by isolated rumen epithelium of sheep.
        Res. Vet. Sci. 1978; 24 (653116): 161-168
        • Martens H.
        • Leonhard-Marek S.
        • Rontgen M.
        • Stumpff F.
        Magnesium homeostasis in cattle: Absorption and excretion.
        Nutr. Res. Rev. 2018; 31 (29318981): 114-130
        • Martin-Tereso J.
        • Martens H.
        Calcium and magnesium physiology and nutrition in relation to the prevention of milk fever and tetany (dietary management of macrominerals in preventing disease).
        Vet. Clin. North Am. Food Anim. Pract. 2014; 30 (25245611): 643-670
        • Martinez N.
        • Risco C.A.
        • Lima F.S.
        • Bisinotto R.S.
        • Greco L.F.
        • Ribeiro E.S.
        • Maunsell F.
        • Galvao K.
        • Santos J.E.
        Evaluation of peripartal calcium status, energetic profile, and neutrophil function in dairy cows at low or high risk of developing uterine disease.
        J. Dairy Sci. 2012; 95 (23021755): 7158-7172
        • McArt J.A.
        • Oetzel G.R.
        A stochastic estimate of the economic impact of oral calcium supplementation in postparturient dairy cows.
        J. Dairy Sci. 2015; 98 (26233451): 7408-7418
        • Na T.
        • Peng J.B.
        TRPV5: A Ca2+ channel for the fine-tuning of Ca2+ reabsorption.
        Handb. Exp. Pharmacol. 2014; 222 (24756712): 321-357
        • Nemeth M.V.
        • Wilkens M.R.
        • Liesegang A.
        Vitamin D status in growing dairy goats and sheep: Influence of ultraviolet B radiation on bone metabolism and calcium homeostasis.
        J. Dairy Sci. 2017; 100 (28822553): 8072-8086
        • Nilius B.
        • Szallasi A.
        Transient receptor potential channels as drug targets: From the science of basic research to the art of medicine.
        Pharmacol. Rev. 2014; 66 (24951385): 676-814
        • Owsianik G.
        • Talavera K.
        • Voets T.
        • Nilius B.
        Permeation and selectivity of TRP channels.
        Annu. Rev. Physiol. 2006; 68 (16460288): 685-717
        • Patra A.K.
        • Geiger S.
        • Braun H.S.
        • Aschenbach J.R.
        Dietary supplementation of menthol-rich bioactive lipid compounds alters circadian eating behaviour of sheep.
        BMC Vet. Res. 2019; 15 (31638982): 352
        • Patra A.K.
        • Geiger S.
        • Schrapers K.T.
        • Braun H.S.
        • Gehlen H.
        • Starke A.
        • Pieper R.
        • Cieslak A.
        • Szumacher-Strabel M.
        • Aschenbach J.R.
        Effects of dietary menthol-rich bioactive lipid compounds on zootechnical traits, blood variables and gastrointestinal function in growing sheep.
        J. Anim. Sci. Biotechnol. 2019; 10 (31827785): 86
        • Patra A.K.
        • Park T.
        • Braun H.S.
        • Geiger S.
        • Pieper R.
        • Yu Z.
        • Aschenbach J.R.
        Dietary bioactive lipid compounds rich in menthol alter interactions among members of ruminal microbiota in sheep.
        Front. Microbiol. 2019; 10 (31551974)2038
        • Peng J.B.
        • Chen X.Z.
        • Berger U.V.
        • Vassilev P.M.
        • Tsukaguchi H.
        • Brown E.M.
        • Hediger M.A.
        Molecular cloning and characterization of a channel-like transporter mediating intestinal calcium absorption.
        J. Biol. Chem. 1999; 274 (10428857): 22739-22746
        • Rabbani I.
        • Siegling-Vlitakis C.
        • Noci B.
        • Martens H.
        Evidence for NHE3-mediated Na transport in sheep and bovine forestomach.
        Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011; 301 (21613579): R313-R319
        • Ramachandran R.
        • Hyun E.
        • Zhao L.N.
        • Lapointe T.K.
        • Chapman K.
        • Hirota C.L.
        • Ghosh S.
        • McKemy D.D.
        • Vergnolle N.
        • Beck P.L.
        • Altier C.
        • Hollenberg M.D.
        TRPM8 activation attenuates inflammatory responses in mouse models of colitis.
        Proc. Natl. Acad. Sci. USA. 2013; 110 (23596210): 7476-7481
        • Reinhardt T.A.
        • Horst R.L.
        • Goff J.P.
        Calcium, phosphorus, and magnesium homeostasis in ruminants.
        Vet. Clin. North Am. Food Anim. Pract. 1988; 4 (3061612): 331-350
        • Reinhardt T.A.
        • Lippolis J.D.
        • McCluskey B.J.
        • Goff J.P.
        • Horst R.L.
        Prevalence of subclinical hypocalcemia in dairy herds.
        Vet. J. 2011; 188 (20434377): 122-124
        • Roche J.R.
        • Berry D.P.
        Periparturient climatic, animal, and management factors influencing the incidence of milk fever in grazing systems.
        J. Dairy Sci. 2006; 89 (16772597): 2775-2783
        • Rodríguez E.M.
        • Aris A.
        • Bach A.
        Associations between subclinical hypocalcemia and postparturient diseases in dairy cows.
        J. Dairy Sci. 2017; 100 (28690056): 7427-7434
        • Rosendahl J.
        • Braun H.S.
        • Schrapers K.T.
        • Martens H.
        • Stumpff F.
        Evidence for the functional involvement of members of the TRP channel family in the uptake of Na+ and NH4+ by the ruminal epithelium.
        Pflugers Arch. 2016; 468 (27184746): 1333-1352
        • Schrapers K.T.
        • Sponder G.
        • Liebe F.
        • Liebe H.
        • Stumpff F.
        The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+.
        PLoS One. 2018; 13 (29494673)e0193519
        • Schröder B.
        • Breves G.
        Mechanisms and regulation of calcium absorption from the gastrointestinal tract in pigs and ruminants: comparative aspects with special emphasis on hypocalcemia in dairy cows.
        Anim. Health Res. Rev. 2006; 7 (17389052): 31-41
        • Schröder B.
        • Goebel W.
        • Huber K.
        • Breves G.
        No effect of vitamin D3 treatment on active calcium absorption across ruminal epithelium of sheep.
        J. Vet. Med. A Physiol. Pathol. Clin. Med. 2001; 48 (11554493): 353-363
        • Schröder B.
        • Rittmann I.
        • Pfeffer E.
        • Breves G.
        In vitro studies on calcium absorption from the gastrointestinal tract in small ruminants.
        J. Comp. Physiol. B. 1997; 167 (9051906): 43-51
        • Schröder B.
        • Vossing S.
        • Breves G.
        In vitro studies on active calcium absorption from ovine rumen.
        J. Comp. Physiol. B. 1999; 169 (10595318): 487-494
        • Schröder B.
        • Wilkens M.R.
        • Ricken G.E.
        • Leonhard-Marek S.
        • Fraser D.R.
        • Breves G.
        Calcium transport in bovine rumen epithelium as affected by luminal Ca concentrations and Ca sources.
        Physiol. Rep. 2015; 3 (26564067)e12615
        • Schweigel M.
        • Kolisek M.
        • Nikolic Z.
        • Kuzinski J.
        Expression and functional activity of the Na/Mg exchanger, TRPM7 and MagT1 are changed to regulate Mg homeostasis and transport in rumen epithelial cells.
        Magnes. Res. 2008; 21 (18705540): 118-123
        • Uppal S.K.
        • Wolf K.
        • Khahra S.S.
        • Martens H.
        Modulation of Na+ transport across isolated rumen epithelium by short-chain fatty acids in hay- and concentrate-fed sheep.
        J. Anim. Physiol. Anim. Nutr. (Berl.). 2003; 87 (14633047): 380-388
        • Uppal S.K.
        • Wolf K.
        • Martens H.
        The effect of short chain fatty acids on calcium flux rates across isolated rumen epithelium of hay-fed and concentrate-fed sheep.
        J. Anim. Physiol. Anim. Nutr. (Berl.). 2003; 87 (14511145): 12-20
        • van de Graaf S.F.
        • Boullart I.
        • Hoenderop J.G.
        • Bindels R.J.
        Regulation of the epithelial Ca2+ channels TRPV5 and TRPV6 by 1α,25-dihydroxy Vitamin D3 and dietary Ca2+.
        J. Steroid Biochem. Mol. Biol. 2004; 89–90 (15225790): 303-308
        • Vandesompele J.
        • De Preter K.
        • Pattyn F.
        • Poppe B.
        • Van Roy N.
        • De Paepe A.
        • Speleman F.
        Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.
        Genome Biol. 2002; 3research0034.1
        • Venjakob P.L.
        • Borchardt S.
        • Heuwieser W.
        Hypocalcemia-Cow-level prevalence and preventive strategies in German dairy herds.
        J. Dairy Sci. 2017; 100 (28865859): 9258-9266
        • Venjakob P.L.
        • Pieper L.
        • Heuwieser W.
        • Borchardt S.
        Association of postpartum hypocalcemia with early-lactation milk yield, reproductive performance, and culling in dairy cows.
        J. Dairy Sci. 2018; 101 (30031579): 9396-9405
        • Vogt-Eisele A.K.
        • Weber K.
        • Sherkheli M.A.
        • Vielhaber G.
        • Panten J.
        • Gisselmann G.
        • Hatt H.
        Monoterpenoid agonists of TRPV3.
        Br. J. Pharmacol. 2007; 151 (17420775): 530-540
        • Wilkens M.R.
        • Kunert-Keil C.
        • Brinkmeier H.
        • Schröder B.
        Expression of calcium channel TRPV6 in ovine epithelial tissue.
        Vet. J. 2009; 182 (18701326): 294-300
        • Wilkens M.R.
        • Mrochen N.
        • Breves G.
        • Schröder B.
        Gastrointestinal calcium absorption in sheep is mostly insensitive to an alimentary induced challenge of calcium homeostasis.
        Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2011; 158 (21122820): 199-207
        • Wilkens M.R.
        • Muscher-Banse A.S.
        Review: Regulation of gastrointestinal and renal transport of calcium and phosphorus in ruminants.
        Animal. 2020; 14 (32024566): s29-s43
        • Wilkens M.R.
        • Nelson C.D.
        • Hernandez L.L.
        • McArt J.A.A.
        Symposium review: Transition cow calcium homeostasis—Health effects of hypocalcemia and strategies for prevention.
        J. Dairy Sci. 2020; 103: 2909-2927
        • Wilkens M.R.
        • Praechter C.
        • Breves G.
        • Schröder B.
        Stimulating effects of a diet negative in dietary cation-anion difference on calcium absorption from the rumen in sheep.
        J. Anim. Physiol. Anim. Nutr. (Berl.). 2016; 100 (25643625): 156-166
        • Wilkens M.R.
        • Richter J.
        • Fraser D.R.
        • Liesegang A.
        • Breves G.
        • Schröder B.
        In contrast to sheep, goats adapt to dietary calcium restriction by increasing intestinal absorption of calcium.
        Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2012; 163 (22776717): 396-406
        • Xu H.X.
        • Ramsey I.S.
        • Kotecha S.A.
        • Moran M.M.
        • Chong J.H.A.
        • Lawson D.
        • Ge P.
        • Lilly J.
        • Silos-Santiago I.
        • Xie Y.
        • DiStefano P.S.
        • Curtis R.
        • Clapham D.E.
        TRPV3 is a calcium-permeable temperature-sensitive cation channel.
        Nature. 2002; 418 (12077604): 181-186
        • Yang W.
        • Shen Z.
        • Martens H.
        An energy-rich diet enhances expression of Na+/H+ exchanger isoform 1 and 3 messenger RNA in rumen epithelium of goat.
        J. Anim. Sci. 2012; 90 (21856899): 307-317
        • Yu X.
        • Yu M.
        • Liu Y.
        • Yu S.
        TRP channel functions in the gastrointestinal tract.
        Semin. Immunopathol. 2016; 38 (26459157): 385-396