Advertisement

The application of the lytic domain of endolysin from Staphylococcus aureus bacteriophage in milk

  • Jiai Yan
    Affiliations
    State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    National Engineering Research Center for Functional Food, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China
    Search for articles by this author
  • Ruijin Yang
    Affiliations
    State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    National Engineering Research Center for Functional Food, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China
    Search for articles by this author
  • Suhuai Yu
    Correspondence
    Corresponding authors
    Affiliations
    State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    National Engineering Research Center for Functional Food, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China
    Search for articles by this author
  • Wei Zhao
    Correspondence
    Corresponding authors
    Affiliations
    State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    National Engineering Research Center for Functional Food, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China

    Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu 214122, P.R. China
    Search for articles by this author
Open ArchivePublished:December 23, 2020DOI:https://doi.org/10.3168/jds.2020-19456

      ABSTRACT

      Staphylococcus aureus is a widespread foodborne pathogen that threatens human health. In particular, multidrug-resistant bacteria such as methicillin-resistant Staphylococcus aureus (MRSA) are emerging problems in modern health care, food safety, and animal health, which require the development of new antimicrobials to replace overused conventional antibiotics. Dairy products can potentially act as vehicles for the transmission of S. aureus and other antibiotic-resistant strains from the farm into the general human population, and should be controlled during the production and storage process. Recently, bacteriophage endolysins, which degrade the cell wall that is indispensable for bacteria, have been deemed promising antimicrobial agents. In this study, one endolysin, LysGH15, demonstrated prominent antimicrobial efficacy against S. aureus, as did its catalytic domain, cysteine, histidine-dependent amidohydrolase/peptidases (CHAP)LysGH15 alone. The LysGH15 and CHAPLysGH15 exhibited different characteristics in one MRSA strain (MRSA 2701), reaching the highest activity under different conditions (35°C and pH 6.0 for LysGH15, 40°C and pH 9.0 for CHAPLysGH15). A difference in the sensitivity of LysGH15 and CHAPLysGH15 to NaCl concentration was found, where the lytic activity of LysGH15 depends strongly on its binding domain's binding capacity, which is positively correlated with the NaCl concentration, whereas the CHAPLysGH15 activity showed a negative correlation with the NaCl concentration. When the NaCl concentration was 450 mM, the lytic activity of LysGH15 reached its peak, whereas the lytic activity of CHAPLysGH15 was the highest in the absence of NaCl. The difference in NaCl sensitivity between LysGH15 and CHAPLysGH15 may be due to the sensitivity of the SH3b binding protein of LysGH15 to NaCl. The CHAPLysGH15 was tested as a biopreservative in whole and skim milk and exerted effective control against S. aureus (declined by approximately 2.5 log10 cfu/mL when incubated at 4°C for 8 h), which suggests promise for application in dairy products.

      Key words

      INTRODUCTION

      Staphylococcus aureus is a frequent colonizer on human skin and mucous membranes (
      • Carr A.L.
      • Daley M.J.
      • Givens Merkel K.
      • Rose D.T.
      Clinical utility of methicillin-resistant staphylococcus aureus nasal screening for antimicrobial stewardship: A review of current literature.
      ). It usually does not cause illness in healthy people, but it has the ability to make toxins that can cause gastrointestinal illness. For instance, under favorable conditions, an enterotoxin that is tolerant to heat, low pH, and proteolytic enzymes could be produced by S. aureus in contaminated food (
      • Marrack P.
      • Kappler J.
      The staphylococcal enterotoxins and their relatives.
      ;
      • Kadariya J.
      • Smith T.C.
      • Thapaliya D.
      Staphylococcus aureus and staphylococcal food-borne disease: An ongoing challenge in public health.
      ). Although S. aureus can be killed in these foods by cooking and preservatives, existing toxins such as enterotoxin are not destroyed and will still be able to cause illness. The ingestion of these contaminated foods will lead to staphylococcal food poisoning, which is the fourth leading cause of foodborne diseases, with an estimated 241,000 illnesses per year in the United States (
      • Wakabayashi Y.
      • Umeda K.
      • Yonogi S.
      • Nakamura H.
      • Yamamoto K.
      • Kumeda Y.
      • Kawatsu K.
      Staphylococcal food poisoning caused by Staphylococcus argenteus harboring staphylococcal enterotoxin genes.
      ). In fact, the number of cases should be higher because many cases are unreported (
      • Bennett S.D.
      • Walsh K.A.
      • Gould L.H.
      Foodborne disease outbreaks caused by Bacillus cereus, Clostridium perfringens, and Staphylococcus aureus—United States, 1998–2008.
      ). Because S. aureus is resistant to salt and can grow in broad pH and temperature ranges (
      • Bergdoll M.S.
      Staphylococcus aureus. In Foodborne Bacterial Pathogens.
      ), it can survive in many different food matrices. Therefore, in addition to causing food poisoning, S. aureus can be transferred to wounds on the hands or wrists during food preparation, eventually causing infection. In particular, the emergence of multidrug-resistant strains such as methicillin-resistant S. aureus (MRSA) makes this infection difficult to address (
      • Reich P.J.
      • Boyle M.G.
      • Hogan P.G.
      • Johnson A.J.
      • Wallace M.A.
      • Elward A.M.
      • Warner B.B.
      • Burnham C.-A.D.
      • Fritz S.A.
      Emergence of community-associated methicillin-resistant Staphylococcus aureus strains in the neonatal intensive care unit: An infection prevention and patient safety challenge.
      ). Therefore, the development of antimicrobial agents against S. aureus in foods is warranted.
      Bacteriophage endolysin, a cell wall lytic enzyme, is a promising bactericidal agent in the food industry. It is produced by bacteriophages at the last stage of proliferation and can specifically and effectively destroy the peptidoglycan of the cell wall to release the bacteriophage, with the aid of holin, which can break the cytoplasmic membrane (
      • Loessner M.J.
      • Kramer K.
      • Ebel F.
      • Scherer S.
      C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates.
      ). Because there is no outer membrane in gram-positive bacteria, endolysin can attack peptidoglycan directly from the outside without holin (
      • Loessner M.J.
      • Kramer K.
      • Ebel F.
      • Scherer S.
      C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates.
      ). The lytic function of endolysin is determined by its specific structure, which usually consists of a cell wall binding domain (CBD) and an enzymatically active domain (EAD;
      • Schmelcher M.
      • Korobova O.
      • Schischkova N.
      • Kiseleva N.
      • Kopylov P.
      • Pryamchuk S.
      • Donovan D.M.
      • Abaev I.
      Staphylococcus haemolyticus prophage ΦSH2 endolysin relies on cysteine, histidine-dependent amidohydrolases/peptidases activity for lysis ‘from without'.
      ;
      • Romero P.
      • Bartual S.G.
      • Schmelcher M.
      • Glück C.
      • Hermoso J.A.
      • Loessner M.J.
      Structural insights into the binding and catalytic mechanisms of the Listeria monocytogenes bacteriophage glycosyl hydrolase PlyP40.
      ). Often, EAD cysteine, histidine-dependent amidohydrolase/peptidases (CHAP) of endolysins from various microorganisms have different activities from the whole endolysin. For instance, the CHAP of LysGH15, CHAPLysGH15, has been reported by
      • Gu J.
      • Feng Y.
      • Feng X.
      • Sun C.
      • Lei L.
      • Ding W.
      • Niu F.
      • Jiao L.
      • Yang M.
      • Li Y.
      • Liu X.
      • Song J.
      • Cui Z.
      • Han D.
      • Du C.
      • Yang Y.
      • Ouyang S.
      • Liu Z.J.
      • Han W.
      Structural and biochemical characterization reveals LysGH15 as an unprecedented “EF-hand-like” calcium-binding phage lysin.
      to have lower activity than the whole enzyme. However,
      • Horgan M.
      • O'Flynn G.
      • Garry J.
      • Cooney J.
      • Coffey A.
      • Fitzgerald G.F.
      • Ross R.P.
      • McAuliffe O.
      Phage lysin LysK can be truncated to its CHAP domain and retain lytic activity against live antibiotic-resistant staphylococci.
      found that the activity of CHAPLysK was twice that of LysK. Previously, NaCl was shown to have different effects on the activities of different endolysins. However, few reports have examined the effect of NaCl on the whole endolysin and its EAD part. Hence, in this paper, we wanted to investigate whether the lower CHAPLysGH15 activity is attributable to the concentration of NaCl used.
      In the modern food industry, it is still a challenge to preserve low-salt foods. In particular, milk is one of the most important foods that has the potential to act as a vehicle for the transmission of S. aureus from farms into the general human population. Endolysin is likely a suitable choice to prevent S. aureus contamination. The lytic activity of some endolysins has been tested in food matrices.
      • Obeso J.M.
      • Martínez B.
      • Rodríguez A.
      • García P.
      Lytic activity of the recombinant staphylococcal bacteriophage PhiH5 endolysin active against Staphylococcus aureus in milk.
      found that the purified recombinant endolysin LysH5 was able to rapidly kill S. aureus growing in pasteurized milk, and the pathogen was not detected after 4 h of incubation at 37°C.
      • García P.
      • Martínez B.
      • Rodríguez L.
      • Rodríguez A.
      Synergy between the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized milk.
      also observed a strong synergistic effect in milk when LysH5 was combined with nisin. Similarly, the amounts of MRSA bacteria in milk and on ham were also significantly reduced (
      • Chang Y.
      • Kim M.
      • Ryu S.
      Characterization of a novel endolysin LysSA11 and its utility as a potent biocontrol agent against Staphylococcus aureus on food and utensils.
      ). However, almost all studies have focused on the whole endolysin, and no in-depth study has been done on the application of its catalytic domain EAD.
      In this study, to investigate the antimicrobial effect of LysGH15 and its catalytic domain CHAPLysGH15 in low-salt food, they were applied in milk. First, LysGH15 and its CBD SH3b and EAD CHAPLysGH15 were further investigated, including their enzymological properties, such as the optimal temperature and pH, and the effect of NaCl concentration on lytic activity. Then, the whole enzyme LysGH15 and CHAPLysGH15 were evaluated in milk to reduce S. aureus contamination.

      MATERIALS AND METHODS

      Medium and Solution

      Escherichia coli BL21 (DE3), used for the expression of recombinant proteins, was purchased from Sangon Biotech Co. Ltd. (Shanghai, China). Staphylococcus aureus strains ATCC6538 and ATCC6538p were purchased from Beijing Beina Chuanglian Biotechnology Research Institute (Beijing, China). The MRSA 2101, MRSA 2107, and MRSA 2701 were isolated from the Affiliated Hospital of Jiangnan University (Wuxi, China). All bacterial strains were grown in Luria-Bertani (LB) broth. The antimicrobial susceptibility tests of 12 antibiotics (vancomycin, tetracycline, methicillin, penicillin, ciprofloxacin, oxacillin, gentamicin, levofloxacin, erythromycin, clindamycin, sulfamethoxazole, and cefoxitin) for 5 S. aureus strains were performed by the microdilution method with cation-adjusted Mueller–Hinton broth (Oxoid, UK) according to the recommendations of the Clinical and Laboratory Standards Institute (
      • Cockerill F.R.
      • Wiker M.A.
      • Alder J.
      • Dudley M.N.
      • Eliopoulos G.M.
      • Ferraro M.J.
      • Hardy D.J.
      • Hecht D.W.
      • Hindler J.A.
      • Patel J.B.
      Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically.
      ).
      The restriction endonucleases quickCut BamHI and XhoI were purchased from Takara Biomedical Technology Co. Ltd. (Beijing, PR China). Other chemicals were purchased from Sinopharm Chemical Reagent Co. Ltd. (Shanghai, PR China). All the chemicals and reagents used in this study were of analytical grade.

      Expression and Purification of LysGH15, EGFP, EGFP-SH3b, and CHAPLysGH15

      Based on the LysGH15 gene sequence (GenBank ID: ADG26756.1), the full-length LysGH15 gene with restriction sites (BamHI and XhoI) was synthesized by Sangon Biotech Co. Ltd. The gene was subcloned into the pET15b vector to construct plasmid pET15b-LysGH15. To study the functions and properties of CBD SH3b, the reporter gene egfp, which encodes the enhanced green fluorescent protein (EGFP), was added to the C-terminus of SH3b. The designed primers for the PCR amplification of the egfp (GenBank ID: JQ064510.1), sh3b, and chap genes are listed in Table 1. The egfp-sh3b gene sequence was obtained using the overlap PCR method with primers in Table 1. The resulting PCR products were subcloned into pET28a with an N-terminal 6 × His-tag sequence to form the plasmids pET28a-EGFP, pET28a-EGFP-SH3b, and pET28a-CHAP. For protein expression, the formed plasmids (3 µL) were transformed into chemically competent E. coli BL21 (DE3) cells (100 µL) by the heat shock method (
      • Froger A.
      • Hall J.E.
      Transformation of plasmid DNA into E. coli using the heat shock method.
      ). The cells were incubated in a shaker incubator (200 rpm) at 37°C for 1 h, and then 50 µL of each transformed cell suspension was pipetted onto LB agar plates with a selection antibiotic and spread using a sterile spreader. The newly grown transformed colonies were picked and cultivated in LB medium supplemented with ampicillin (50 μg/mL to pET15b-LysGH15; Sangon Biotech Co. Ltd.) or kanamycin (50 μg/mL to pET28a-EGFP, pET28a-EGFP-SH3b, and pET28a-CHAP; Sangon Biotech Co. Ltd.) at 37°C and 200 rpm. For the E. coli BL21 (DE3)/pET15b-LysGH15 cells, once an optical density at 600 nm (OD600) of 0.6 was reached, cultures were cooled to 28°C, and isopropyl-β-d-thiogalactopyranoside (final concentration of 0.05 mM; Sangon Biotech Co. Ltd.) was added to induce protein expression at this temperature. The cultivation conditions of the cells [E. coli BL21 (DE3)/pET28a-EGFP, E. coli BL21 (DE3)/pET28a-EGFP-SH3b, and E. coli BL21 (DE3)/pET28a-CHAP] were the same as those of the E. coli BL21 (DE3)/pET15b-LysGH15 cells except that the temperature of protein expression (22°C for EGFP and EGFP-SH3b and 26°C for CHAPLysGH15) and the final concentration of isopropyl-β-d-thiogalactopyranoside (0.2 mM for EGFP and EGFP-SH3b and 0.08 mM for CHAPLysGH15) were different. After 6 h, cells were harvested by centrifugation (10,000 × g for 5 min at 4°C) and resuspended in buffer (20 mM sodium phosphate, 200 mM NaCl, pH 7.4). Cells were disrupted using an ultrasonicator (Nanjing Safer Biotech Co. Ltd., Nanjing, China) for 10 min (pulse on: 5 s, pulse off: 5 s).
      Table 1The PCR primers in this paper
      Restriction sites are underlined. F = forward; R = reverse.
      GenePrimer sequence
      egfp-FCGCGGATCCATGAGTAAAGGAGAAG
      egfp-RCCGCTCGAGTTATTTGTATAGTTCATCC
      egfp-F1CGCGGATCCATGAGTAAAGGAGAAGAAC
      egfp-R1ACTATACAAAACACAAGGAAGACCATCTC
      sh3b-FTCCTTGTGTTTTGTATAGTTCATCCATGCC
      sh3b-RCCGCTCGAGCTATTTGAATACTCCCC
      chap-FCGCGGATCCGCTAAGACTC
      chap-RCCCAAGCTTTTATGCTTTTACAGGT
      1 Restriction sites are underlined. F = forward; R = reverse.
      The purification of the recombinant proteins EGFP, EGFP-SH3b, and CHAPLysGH15 was performed using Ni-NTA and Ni-TED Sedinose Resin columns (Sangon Biotech Co. Ltd.) according to the manufacturer's instructions. The Ni-TED column prebalanced with PBS (20 mM sodium phosphate, 200 mM NaCl, pH 7.4) was washed with PBS containing 50 mM imidazole (Sangon Biotech Co. Ltd.), and the protein sample was finally eluted with PBS containing 200 mM imidazole. To purify LysGH15, sample solution in PBS (20 mM sodium phosphate, 100 mM NaCl, pH 7.4) was first loaded to the Ni-NTA column, removing a miscellaneous protein showing a similar molecular weight to LysGH15 but high affinity to Ni2+ at 100 mM NaCl (LysGH15 showed high affinity to Ni2+ at 500 mM but not at 100 mM NaCl). The eluate was collected, added to NaCl to a final concentration of 500 mM, and subsequently reloaded on the Ni-NTA column to purify LysGH15. The identity and purity of the proteins (LysGH15, EGFP-SH3b, and CHAPLysGH15) were confirmed by SDS-PAGE. Purified proteins were exchanged into phosphate buffer solution (PB; 20 mM, pH 7.4, NaCl 0 mM) using an ultrafiltration tube (GE Healthcare, Amersham, Bucks, UK), and the concentrations were measured by a Nanodrop 2000 (Thermo Fisher Scientific Co. Ltd., Shanghai, China). The solutions were stored at 4°C for no more than 2 wk.

      Preparation of S. aureus Suspension

      A single colony of MRSA 2701 was inoculated into 5 mL of LB broth and cultivated overnight at 37°C and 150 rpm. Then, fresh culture was inoculated with 1% (vol/vol) and cultivated under the same conditions until the OD600 reached 0.6 to 0.8. Cells were collected through centrifugation (10,000 × g, 25°C, 3 min) and washed twice with PBS (20 mM, pH 7.4, and NaCl 500 mM) for LysGH15 or PB (20 mM, pH 7.4) for CHAPLysGH15. The OD600 of MRSA 2701 was adjusted by changing the amount of buffer so that the initial OD600 was 1.2 ± 0.05.

      Characterization of LysGH15 and CHAPLysGH15

      The lytic activities of LysGH15 and CHAPLysGH15 were determined according to Son's method with some modifications (
      • Son B.
      • Yun J.
      • Lim J.A.
      • Shin H.
      • Heu S.
      • Ryu S.
      Characterization of LysB4, an endolysin from the Bacillus cereus-infecting bacteriophage B4.
      ). The initial OD600 value of each bacterial suspension was 0.6 ± 0.05 (
      • Filatova L.Y.
      • Donovan D.M.
      • Ishnazarova N.T.
      • Foster-Frey J.A.
      • Becker S.C.
      • Pugachev V.G.
      • Balabushevich N.G.
      • Dmitrieva N.F.
      • Klyachko N.L.
      A chimeric LysK-Lysostaphin fusion enzyme lysing Staphylococcus aureus cells: A study of both kinetics of inactivation and specifics of interaction with anionic polymers.
      ). After adding the same volume of LysGH15 and CHAPLysGH15, the OD600 values (0.6 ± 0.05) of the suspension of every strain were periodically recorded every 10 s for 10 min at 37°C. The reaction buffer was PBS (20 mM, pH 7.4, NaCl 500 mM) for LysGH15 and PB (20 mM, pH 7.4) for CHAPLysGH15.
      The lytic activities of LysGH15 and CHAPLysGH15 were measured at different temperatures (4°C, 25–60°C), in different buffer systems (20 mM citrate buffer, pH 3.0–6.0; 20 mM sodium phosphate buffer, pH 7.0–8.0; and 20 mM Tris-HCl buffer, pH 9.0–10.0), and at different NaCl concentrations (0–500 mM). When the optimal temperature was measured, the reaction pH was 7.4, and the NaCl concentration was 500 mM for LysGH15 and 0 mM for CHAPLysGH15. From 20 to 60°C, the enzyme activity was detected every 5°C. The enzyme solution and suspension were preheated in a water bath (Changzhou Guohua Electric Appliance Co., Ltd., Changzhou, China) for 5 min and then added to the enzyme plate to measure the absorbance change at OD600 by a multimode reader (Biotec Co. Ltd., Carrollton, TX). When the optimal pH was measured, the reaction temperature was 37°C, and the NaCl concentration was 500 mM for LysGH15 and 0 mM for CHAPLysGH15. Similarly, when the effect of NaCl concentration was examined, the pH was 7.4, and the temperature was 37°C.
      One unit of enzyme was defined as the reciprocal of the highest dilution that caused a 50% decrease in absorbance after 15 min of incubation at 35°C (for LysGH15) or 40°C (for CHAPLysGH15) compared with the absorbance of the control well (
      • Loeffler J.M.
      • Nelson D.
      • Fischetti V.A.
      Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase.
      ). Specific activity was calculated according to the change in OD600 per micromole of protein per minute (that is, ΔOD600/µmol per min). Relative activity was expressed as a percentage of the maximal enzyme activity.

      Binding Ability of EGFP-SH3b

      The binding ability of EGFP-SH3b to the MRSA 2701 cell wall was quantitatively detected by fluorescence scanning. Two hundred fifty microliters of purified EGFP-SH3b (0.25 mg/mL) was mixed with an equal proportion of MRSA 2701 suspension (PBS suspension) and kept at 30°C without shaking for 10 min. Then, centrifugation was performed at room temperature (∼25°C) at 6,000 × g for 2 min. After washing twice with PBS (20 mM, pH 7.4, NaCl 500 mM), the pellet was resuspended with PBS, and an appropriate amount was placed on a slide and fixed with a cover glass. The sample was observed under an inverted fluorescence microscope with EGFP as a control.

      Effect of Milk Components on the Activity of LysGH15 and CHAPLysGH15

      The lactose, sodium, and fat contents in whole cow milk were approximately 4.7%, 0.049%, and 3.7%, respectively (
      • Turck D.
      Cow's milk and goat's milk.
      ). Hence, lactose solution (4.7%) was prepared with buffer PBS (phosphate 20 mM, NaCl 500 mM, pH 7.4) for LysGH15, PB (20 mM, pH 7.4) for CHAPLysGH15. The NaCl solution (0.049%) was prepared with PB (20 mM, pH 7.4).
      The extraction of milk fat was performed according to the method reported by
      • Castro-Gómez M.P.
      • Rodriguez-Alcalá L.M.
      • Calvo M.V.
      • Romero J.
      • Mendiola J.A.
      • Ibañez E.
      • Fontecha J.
      Total milk fat extraction and quantification of polar and neutral lipids of cow, goat, and ewe milk by using a pressurized liquid system and chromatographic techniques.
      . The steps are as follows: milk was weighed after freeze-drying and placed in centrifuge tubes with trinonanoin previously added as an internal standard. Fifteen milliliters of a dichloromethane-methanol solution (2:1, vol/vol) was then added to each tube. The mixture was shaken mechanically for 30 min and centrifuged at 6,600 × g for 5 min at 4°C. As much as possible of the upper organic solvent fraction was carefully removed with a pipette. The sediment was washed with a dichloromethane-methanol solution (2:1, vol/vol), and after shaking for 1 min, the sample was again centrifuged at 6,600 × g for 5 min at 4°C. The removed organic solvent was combined with that previously collected, and a 0.9% solution of sodium chloride was added and mixed mechanically for 1 min before the tubes were stored overnight at 4°C. Afterward, they were again centrifuged at 6,600 × g for 5 min at 4°C, and the bottom dichloromethane layer was collected and filtered through Whatman 1-phase separator filter paper (Whatman, Maidstone, UK) containing anhydrous sodium sulfate. Finally, the extract was concentrated by removing dichloromethane in a rotatory evaporator and dried under a gentle stream of nitrogen. The extracted fat was added to 10 mL of PBS (for LysGH15) or PB (for CHAPLysGH15) containing 0.1% Tween-80 and emulsified at 30°C as a fat simulation solution.
      One milliliter of MRSA 2701 (initial OD600 = 1.2) was centrifuged at 10,000 × g for 3 min at 4°C and added to 1 mL of milk component simulation solution for resuspension. Then, the system was mixed with enzyme solution (25 nM) in equal proportions (buffer was used instead of enzyme solution in the control group) to measure the OD600 drop value at 37°C after 5 min.

      Determination of Circular Dichroism

      Phosphate-buffered saline (20 mM, NaCl concentrations from 0 to 500 mM, pH 7.4) was used as a blank, and the scanning wavelength range was set to 190–250 nm with a scanning speed of 50 nm/min at 25°C (scanning 5 times). The circular dichroism (CD) spectra of LysGH15 and CHAPLysGH15 (0.1 mg/mL) in different buffers were recorded. The buffers were PB (20 mM, pH 7.4) with different NaCl concentrations (0, 100, 200, and 500 mM).

      Binding Ability of EGFP-SH3b to MRSA in Milk

      The MRSA 2701 (OD600 = 1.2) of 2 mL was collected and resuspended in different milk solutions, including whole milk, skim milk, whole milk with 500 mM NaCl, and skim milk with 500 mM NaCl. Sixty microliters of EGFP-SH3b (5 nM) was added and incubated without shaking at 30°C (based on our previous experimental results, not shown in this paper, the binding ability of SH3b was best at 30°C) for 5 min. After centrifugation (6,000 × g, 2 min, ∼25°C), the pellet was washed 3 times with PBS and resuspended in 4 mL of buffer solution for fluorescence intensity measurement. The excitation wavelength was 415 nm, and the scanning range was 450 to 600 nm. The experimental group without EGFP-SH3b was used as a blank control, and PBS without milk but with EGFP-SH3b was used as a positive control.

      Antimicrobial Activity of LysGH15 and CHAPLysGH15 in Milk

      The lytic activity of LysGH15 against the MRSA 2701 strain was tested in whole milk and skim milk. The milk samples (100 mL) with different NaCl (sterilized by UV) concentrations (0, 250, and 500 mM) were inoculated with 1 mL of MRSA 2701 cells (108 cfu/mL) at the exponential growth phase. The milk samples were preincubated at 4°C for 10 min to allow the bacteria to adapt to each condition and subsequently incubated with 27.5 μL of LysGH15 (25 nM) at 4°C for 8 h. Samples (25 mL) were withdrawn every 2 h, and the plate counting method was used to count viable MRSA 2701 in the samples (
      • Park Y.H.
      • Seo K.S.
      • Ahn J.S.
      • Yoo H.S.
      • Kim S.P.
      Evaluation of the petrifilm plate method for the enumeration of aerobic microorganisms and coliforms in retailed meat samples.
      ). Briefly, using 10-fold dilution with 0.85% saline, the sample was diluted serially to 10−7. Each sample of 100 μL in the range of 10−5 to 10−7 was pipetted and spread on LB agar. After incubation for 24 h at 37°C, the total number of colonies was counted.
      The lytic activity of CHAPLysGH15 (25 nM) was also tested in milk with MRSA 2701 in whole milk and skim milk at 4°C. The method was the same as that for LysGH15 but without NaCl. The nutritional information of the milk is listed in Table 2.
      Table 2Nutrition facts on the commercial milk used in this paper
      These data are derived from the milk labels.
      CompositionWhole milkSkim milk
      Energy (kJ)280179
      Protein (g)3.23.0
      Fat (g)3.80
      Carbohydrate (g)5.04.7
      Na (mg)5367
      Ca (mg)100105
      1 These data are derived from the milk labels.

      Statistical Analysis

      Each experiment was independently conducted at least 3 times. All statistical analyses were conducted with SAS software (version 8.0, SAS Institute Inc., Cary, NC), and P < 0.05 was used to determine the statistical significance in all tests. Error bars represent standard deviation.

      RESULTS AND DISCUSSION

      Purification and Characterization of LysGH15

      The plasmid pET15b-LysGH15 was constructed by cleavage and ligation (Figure 1a). The LysGH15 was purified by Ni+ affinity chromatography. The SDS-PAGE revealed a single band of purified LysGH15 at approximately 55 kDa (Figure 1b). The concentration of LysGH15 was 5.0 ± 0.12 mg/mL. As shown in Figure 1c, the 5 strains containing 3 MRSA strains (2102, 2107, and 2701) could be lysed despite different lysis levels, indicating that LysGH15 can be used for the control of S. aureus and MRSA. Given the difficulty of eliminating MRSA due to its drug resistance, the S. aureus strain (MRSA 2701) showing resistance to the largest number of drugs (Table 3) was chosen for further investigation.
      Figure thumbnail gr1
      Figure 1Purified LysGH15 and its enzymatic properties. (a) Construction of the expression plasmid pET15b-LysGH15. (b) SDS-PAGE analysis of purified LysGH15. (c) Turbidity reduction curve of Staphylococcus aureus strains (±SD) treated with LysGH15 in PBS. Due to the high concentration of endolysin, the optical density at 600 nm (OD600) of the S. aureus suspension decreased rapidly and then tended to remain flat and basically unchanged, so only 150 s of data are shown. The error bar in some points was too small to display. (d) The optimum reaction temperature of LysGH15 (±SD) against methicillin-resistant Staphylococcus aureus (MRSA) 2701 in PBS. From 20 to 60°C, the enzyme activity was detected every 5°C. (e) The optimum pH of LysGH15 (±SD) against MRSA 2701 at 35°C. (f) The effect of NaCl on the lytic activity of LysGH15 (±SD) against MRSA 2701 at 35°C. (g) Far-UV circular dichroism spectroscopy analysis of LysGH15 protein at different NaCl concentrations (0, 100, 200, and 500 mM). deg = degrees. ATCC = American Type Culture Collection. PB = phosphate buffer solution (20 mM, pH 7.4, NaCl 0 mM).
      Table 3The drug resistance results of the Staphylococcus aureus strains used in this paper
      ATCC = American Type Culture Collection; MRSA = methicillin-resistant Staphylococcus aureus; R = drug resistance; S = sensitivity; I = mediator; + = positive; − = negative; blank = unknown.
      AntibioticS. aureus ATCC6538pS. aureus ATCC6538MRSA 2101MRSA 2107MRSA 2701
      VancomycinSSSSS
      TetracyclineSISSRS
      MethicillinSSSRR
      PenicillinSIRRR
      CiprofloxacinSSRR
      OxacillinSSSRR
      GentamicinSSSRR
      LevofloxacinSSRR
      ErythromycinISSSR
      ClindamycinSISSR
      SulfamethoxazoleSSR
      Cefoxitin++
      1 ATCC = American Type Culture Collection; MRSA = methicillin-resistant Staphylococcus aureus; R = drug resistance; S = sensitivity; I = mediator; + = positive; − = negative; blank = unknown.
      As shown in Figure 1d, the lytic activity of LysGH15 was enhanced with increasing temperature, reached a maximum at 35°C, and significantly decreased thereafter. This could be related to the low heat stability of LysGH15 (
      • Gu J.
      • Xu W.
      • Lei L.
      • Huang J.
      • Feng X.
      • Sun C.
      • Du C.
      • Zuo J.
      • Li Y.
      • Du T.
      • Li L.
      • Han W.
      LysGH15, A novel bacteriophage lysin, protects a murine bacteremia model efficiently against lethal methicillin-resistant Staphylococcus aureus infection.
      ). The LysGH15 was active over a broad pH range (pH 6.0–10.0) and exhibited maximum activity at pH 6.0 to 7.0 (Figure 1e). Although the buffer used was different from that in a previous study (
      • Gu J.
      • Xu W.
      • Lei L.
      • Huang J.
      • Feng X.
      • Sun C.
      • Du C.
      • Zuo J.
      • Li Y.
      • Du T.
      • Li L.
      • Han W.
      LysGH15, A novel bacteriophage lysin, protects a murine bacteremia model efficiently against lethal methicillin-resistant Staphylococcus aureus infection.
      ), LysGH15 showed optimal activity at the same temperature and pH (35°C and pH 6.0). There was little activity when the pH was lower than 5.5. The LysGH15 showed a broad activity range from pH 6.0 to 10.0, indicating that LysGH15 function within a broad pH range. It was reported that the LysK-lysostaphin fusion protein had a wide pH range because of 4 pH-sensitive AA residue groups. Two groups are a histidine residue with a pK of 6.0 and metal ion with a pK of 9.6 from LysK, and 2 groups are glutamic acid with a pK of 5.9 and histidine residue with a pK of 9.2 from lysostaphin (
      • Filatova L.Y.
      • Becker S.C.
      • Donovan D.M.
      • Gladilin A.K.
      • Klyachko N.L.
      LysK, the enzyme lysing Staphylococcus aureus cells: Specific kinetic features and approaches towards stabilization.
      ,
      • Filatova L.Y.
      • Donovan D.M.
      • Ishnazarova N.T.
      • Foster-Frey J.A.
      • Becker S.C.
      • Pugachev V.G.
      • Balabushevich N.G.
      • Dmitrieva N.F.
      • Klyachko N.L.
      A chimeric LysK-Lysostaphin fusion enzyme lysing Staphylococcus aureus cells: A study of both kinetics of inactivation and specifics of interaction with anionic polymers.
      ). Moreover, the reported LysGH15 structure revealed that CHAP of the enzyme had a Cys-His-Glu-Asn quartet active site and a calcium-binding site (
      • Gu J.
      • Feng Y.
      • Feng X.
      • Sun C.
      • Lei L.
      • Ding W.
      • Niu F.
      • Jiao L.
      • Yang M.
      • Li Y.
      • Liu X.
      • Song J.
      • Cui Z.
      • Han D.
      • Du C.
      • Yang Y.
      • Ouyang S.
      • Liu Z.J.
      • Han W.
      Structural and biochemical characterization reveals LysGH15 as an unprecedented “EF-hand-like” calcium-binding phage lysin.
      ). Most likely, these residues and metal ions that are similar to those of the LysK-lysostaphin fusion protein also contributed to the activity of LysGH15 within a wide pH range (
      • Filatova L.Y.
      • Donovan D.M.
      • Ishnazarova N.T.
      • Foster-Frey J.A.
      • Becker S.C.
      • Pugachev V.G.
      • Balabushevich N.G.
      • Dmitrieva N.F.
      • Klyachko N.L.
      A chimeric LysK-Lysostaphin fusion enzyme lysing Staphylococcus aureus cells: A study of both kinetics of inactivation and specifics of interaction with anionic polymers.
      ). Because the lytic activity of LysGH15 was seriously inhibited at pH 5.0 and reached a maximum at pH 6.0, it was very important to maintain the system pH at a weakly acidic level when LysGH15 was applied in food.
      As shown in Figure 1f, the concentration of NaCl in buffer greatly influenced the activity of LysGH15. The LysGH15 had almost no lytic activity (only 6.0 ± 1.92%) without NaCl. As the concentration increased, the specific activity increased, and the optimal concentration of NaCl was 450 mM. Within the high NaCl concentration range (500–750 mM), the activity was stable overall, indicating that a high NaCl concentration facilitates LysGH15 activity. Sometimes, the addition of a suitable amount of NaCl can influence protein structure, increasing hydrophobic interactions and enhancing the stability of protein globules (
      • Filatova L.Y.
      • Donovan D.M.
      • Ishnazarova N.T.
      • Foster-Frey J.A.
      • Becker S.C.
      • Pugachev V.G.
      • Balabushevich N.G.
      • Dmitrieva N.F.
      • Klyachko N.L.
      A chimeric LysK-Lysostaphin fusion enzyme lysing Staphylococcus aureus cells: A study of both kinetics of inactivation and specifics of interaction with anionic polymers.
      ). Obviously, as shown in Figure 1g, the secondary structure reflected by the CD spectrum changed, indicating that the higher activity of LysGH15 at a high concentration of NaCl is probably attributable to this structural change. However, it is unknown whether the binding ability of the binding domain or the activity of the catalytic domain was affected by the addition of sodium chloride, leading to a change in the whole enzyme activity.

      Bactericidal Activity of LysGH15 Against MRSA in Milk

      The possibility of LysGH15 application in milk may be directly reflected by studying the lytic activity of LysGH15 with different simulated milk components. The previous conclusion shows that the activity of LysGH15 was very low without NaCl. Therefore, to study the effect of lactose on the activity of LysGH15, PBS (20 mM, pH 7.4, NaCl 500 mM) was used to prepare the solution to make LysGH15 active. As shown in Figure 2a, lactose caused a relatively low decrease in the lytic activity of LysGH15, which can be maintained at approximately 83.71 ± 1.25% of activity. In contrast, the lytic activity of LysGH15 was strongly inhibited and only 5.34 ± 2.02% in the fat (3.7%) solution prepared with PBS (20 mM, pH 7.4, NaCl 500 mM), indicating that fat had a significant effect on LysGH15 activity. Equally, the lytic activity of LysGH15 in NaCl (0.049%) solution prepared with PB was only 6.86 ± 1.09%, which was consistent with the previous results showing that the lytic activity of LysGH15 was almost 0 in the absence of NaCl. Therefore, the influence of the concentrations of NaCl and milk fat on the bactericidal ability of LysGH15 was mainly discussed in relation to milk.
      Figure thumbnail gr2
      Figure 2Lytic activity of LysGH15 in milk. (a) Influence of milk components on the activity of LysGH15 (±SD) at 35°C. (b) Lytic activity of LysGH15 (±SD) against methicillin-resistant Staphylococcus aureus in milk at 4°C after the addition of different NaCl concentrations (0, 250, and 500 mM).
      Whole milk and skim milk with different concentrations of NaCl were chosen to study the effects of fat and NaCl on the antimicrobial efficacy of LysGH15 in milk (Figure 2b). In contrast to LysH5, which can maintain high activity without NaCl in milk (
      • Obeso J.M.
      • Martínez B.
      • Rodríguez A.
      • García P.
      Lytic activity of the recombinant staphylococcal bacteriophage PhiH5 endolysin active against Staphylococcus aureus in milk.
      ;
      • García P.
      • Martínez B.
      • Rodríguez L.
      • Rodríguez A.
      Synergy between the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized milk.
      ), LysGH15 did not show significant bactericidal activity (P > 0.05), and the growth rate of MRSA slightly increased, which was the same as the behavior in the control group. When the concentration of NaCl was increased to 500 mM, the activity of LysGH15 did not increase significantly compared with that at 250 mM NaCl. Therefore, it could be concluded that the presence of NaCl in the milk system was essential for LysGH15 to exert its bactericidal activity in milk. As shown in Figure 2b, the lytic effect of LysGH15 was faster in skim milk than in whole milk, which means that the low-fat environment was more favorable for bactericidal activity. This may be because the fat affected the binding of LysGH15 to MRSA 2701 cells (Figure 2a). Meanwhile, the MRSA counts did not show clear differences between the 250 and 500 mM NaCl skim milk treatments, which may be because milk is a more complex system than PBS. However, it is not clear how NaCl affects the lytic activity of LysGH15 or whether NaCl affects the lytic activity of the catalytic domain or the binding ability of the binding domain. Therefore, we further studied the properties of the binding domain and the catalytic domain and their applications in milk.

      Purification of EGFP-SH3b and Binding Ability of EGFP-SH3b Toward MRSA in Different Milk Solutions

      To observe the binding ability between lysin and S. aureus directly, a plasmid fused with the reporter genes EGFP and SH3b (binding domain) was constructed (Figure 3a) and then transformed into the expression strain E. coli BL21 (DE3). The EGFP-SH3b was purified by Ni+ affinity chromatography. The SDS-PAGE revealed a single band of purified EGFP-SH3b at approximately 47 kDa (Figure 3b). The binding ability between lysin and S. aureus was investigated by fluorescence imaging. As shown in Figure 3c, EGFP showed no fluorescence emission (Figure 3c-III and 3c-IV), but the fusion protein EGFP-SH3b produced a notable green fluorescence spot, indicating that SH3b was specifically bound to MRSA 2701.
      Figure thumbnail gr3
      Figure 3Purified enhanced green fluorescent protein (EGFP)-SH3b and its binding ability. (a) Construction of the expression plasmid pET28a-EGFP-SH3b. (b) SDS-PAGE analysis of purified EGFP-SH3b. (c) Binding of EGFP-SH3b to the cell wall of methicillin-resistant Staphylococcus aureus 2701 at 30°C. I. Imaging of EGFP-SH3b in the bright field. II. Imaging of EGFP-SH3b in the fluorescence module. III. Imaging of EGFP in the bright field. IV. Imaging of EGFP in the fluorescence module.
      The binding ability of EGFP-SH3b with MRSA 2701 in milk was also studied. As shown in Figure 4, the fluorescence intensity values were approximately 37,176 ± 4,031 arbitrary units (AU) in PBS. However, when the buffer was replaced with whole milk, the fluorescence intensity decreased to 14,677 ± 1,574 AU. Nevertheless, after 500 mM NaCl was added to the whole milk, the fluorescence intensity increased to 36,271 ± 66 AU. There was a similar experimental trend for skim milk, and the amplitude of the increase was larger. The results revealed that the binding activity of EGFP-SH3b to MRSA 2701 was sensitive to NaCl, showing that the high lytic activity of LysGH15 at high NaCl concentrations (>100 mM) was related to the binding ability of its binding domain SH3b. The low lytic ability of LysGH15 in milk was probably due to the low NaCl concentration of milk, which causes the low binding efficacy of SH3b. This result was similar to those in the study of
      • Loessner M.J.
      • Kramer K.
      • Ebel F.
      • Scherer S.
      C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates.
      .
      Figure thumbnail gr4
      Figure 4The binding ability of enhanced green fluorescent protein (EGFP)-SH3b (±SD) toward methicillin-resistant Staphylococcus aureus in different milk solutions at 30°C. AU = arbitrary units.

      Lytic Activity and Properties of CHAPLysGH15

      The CHAPLysGH15 gene was subcloned into the pET28a plasmid, constructing the prokaryotic expression vector pET-28a-CHAP (Figure 5A). The SDS-PAGE showed a band of purified CHAPLysGH15 of approximately 22 kDa, corresponding to its theoretical value (Figure 5B). The concentration of CHAPLysGH15 was 4.5 mg/mL. Similar to LysGH15, CHAPLysGH15 could rapidly cleave 5 S. aureus strains containing 3 MRSA strains (2101, 2107, and 2701), indicating that CHAPLysGH15 can be used for the control of S. aureus and MRSA (Figure 5C). This result was different from the finding by
      • Gu J.
      • Feng Y.
      • Feng X.
      • Sun C.
      • Lei L.
      • Ding W.
      • Niu F.
      • Jiao L.
      • Yang M.
      • Li Y.
      • Liu X.
      • Song J.
      • Cui Z.
      • Han D.
      • Du C.
      • Yang Y.
      • Ouyang S.
      • Liu Z.J.
      • Han W.
      Structural and biochemical characterization reveals LysGH15 as an unprecedented “EF-hand-like” calcium-binding phage lysin.
      that the lytic activity of CHAP was low. A possible reason was the differences in NaCl concentrations in the buffer, namely, 137 mM in Gu et al.'s research and no NaCl in our experiment.
      Figure thumbnail gr5
      Figure 5Purified cysteine, histidine-dependent amidohydrolase/peptidases (CHAP)LysGH15 and its enzymatic properties. (A) Construction of the expression plasmid pET28a-CHAP. (B) SDS-PAGE analysis of CHAPLysGH15. (C) Turbidity reduction curve of Staphylococcus aureus strains (±SD) treated with CHAPLysGH15 in phosphate buffer solution (PB; 20 mM, pH 7.4, NaCl 0 mM). Due to the high concentration of endolysin, the optical density at 600 nm (OD600) of the S. aureus suspension decreased rapidly and then tended to remain flat and basically unchanged, so only 150 s of data are shown. The error bars for some points were too small to display. (D) The optimum reaction temperature of CHAPLysGH15 (±SD) against methicillin-resistant Staphylococcus aureus (MRSA) 2701 in PB. From 20 to 60°C, the enzyme activity was detected every 5°C. The enzyme solution and suspension were preheated in a water bath for 5 min and then added to the enzyme plate to measure the absorbance change of OD600. (E) The optimum pH of CHAPLysGH15 (±SD) against MRSA 2701 at 40°C in PB. (F) The effect of the concentration of NaCl on the lytic activity of CHAPLysGH15 (±SD) against MRSA 2701 at 40°C in PB. (G) Far-UV circular dichroism spectroscopy analysis of CHAPLysGH15 protein at different NaCl concentrations (0, 100, and 200 mM). deg = degrees. ATCC = American Type Culture Collection.
      The influence of temperature and pH on CHAPLysGH15 activity was also investigated. As shown in Figure 5D, the lytic activity increased with increasing temperature, reached a maximum at 40°C, and then significantly decreased. The turbidity of the MRSA 2701 cell suspension (OD600) decreased by 50% within 2 min after adding CHAPLysGH15 at 40°C. Although the activities could be maintained at approximately 40% in the range of 45 to 55°C, they disappeared after heat treatment for 8 to 10 min. The optimal temperature of CHAPLysGH15 (40°C) was 5°C higher than that of the whole enzyme LysGH15 (35°C); however, both enzymes are sensitive to high temperature (
      • Gu J.
      • Xu W.
      • Lei L.
      • Huang J.
      • Feng X.
      • Sun C.
      • Du C.
      • Zuo J.
      • Li Y.
      • Du T.
      • Li L.
      • Han W.
      LysGH15, A novel bacteriophage lysin, protects a murine bacteremia model efficiently against lethal methicillin-resistant Staphylococcus aureus infection.
      ), indicating that CHAPLysGH15 is more suitable for application at low temperature.
      Because of the variety of pH values in foods, the pH sensitivity of CHAPLysGH15 was also tested. As shown in Figure 5E, CHAPLysGH15 had no lytic activity at low pH (<5.5) but was highly active under alkaline conditions and reached the highest activity at pH 9.0. At pH 10.0, the lytic activity of CHAPLysGH15 remained at 70% (Figure 5E), indicating that CHAPLysGH15 was more suitable for use in nonacid food. Furthermore, the relative activity of CHAPLysGH15 is still approximately 60% at approximately pH 7.0. The pH of whole milk (6.4–6.8) is also approximately 7.0 (
      • Helmenstine A.M.
      “What Is the Acidity or pH of Milk?”.
      ); hence, CHAPLysGH15 can be used in milk to control S. aureus contamination.
      As shown in Figure 5F, the activity of CHAPLysGH15 was negatively correlated with the NaCl concentration at the optimal temperature and pH. The lytic activity without NaCl was high but was completely lost when 300 mM NaCl was added, indicating that CHAPLysGH15 is sensitive to NaCl. This result is similar to the report by
      • Mao J.
      • Schmelcher M.
      • Harty W.J.
      • Foster-Frey J.
      • Donovan D.M.
      Chimeric Ply187 endolysin kills Staphylococcus aureus more effectively than the parental enzyme.
      that CHAPPly187 in a high concentration of NaCl (300 mM) buffer showed low lytic activity. Similar to LysGH15, the CD spectrum revealed that the structure of CHAPLysGH15 changed with increasing NaCl concentration (Figure 5G). Because of the entirely different dependence of CHAPLysGH15 and SH3b on NaCl, it can be concluded that the need of LysGH15 for NaCl can be attributed to the dependence of the binding domain SH3b on NaCl. Therefore, CHAPLysGH15 probably has good application prospects in low-salt food (0–50 mM). Given the high activity of CHAPLysGH15 at low salt levels, we continued to study its antimicrobial effect in milk systems.

      Bactericidal Activity of CHAPLysGH15 Against MRSA in Milk

      The bactericidal effect of CHAPLysGH15 in milk was investigated further. First, the effects of different milk components on the lytic activity of CHAPLysGH15 were studied. The lactose, fat, and NaCl solutions were prepared with PB (20 mM, pH 7.4). As shown in Figure 6a, like LysGH15 (Figure 2a), lactose had little influence on CHAPLysGH15 activity (only reduced by approximately 15%). However, unlike LysGH15 (Figure 2a), NaCl and fat had no significant influence on CHAPLysGH15 activity. The CHAPLysGH15 does not contain a binding domain SH3b that is influenced by NaCl (Figure 4); therefore, the result here also indirectly confirms that NaCl affects LysGH15 activity through its binding domain.
      Figure thumbnail gr6
      Figure 6Lytic activity of cysteine, histidine-dependent amidohydrolase/peptidases (CHAP)LysGH15 in milk. (a) The effect of milk components on the lytic activity of CHAPLysGH15 (±SD). (b) Lytic activity of CHAPLysGH15 (±SD) against methicillin-resistant Staphylococcus aureus 2701 at 4°C in whole milk and skim milk. PB = phosphate buffer solution (20 mM, pH 7.4, NaCl 0 mM).
      Subsequently, the bactericidal activity of CHAPLysGH15 was tested in whole milk and skim milk. As shown in Figure 6b, the viable amounts of MRSA in whole milk and skim milk all decreased significantly, which was consistent with the previous study showing that the lytic activity of CHAPLysGH15 was not affected by fat. The CHAPLysGH15 (25 nM, 8 h treatment at 4°C) reduced the number of MRSA 2701 cells in milk by approximately 2.5 log10 cfu/mL per milliliter. Fluid milk, which is the food target for this study, is not supplemented with salt. The CHAPLysGH15 has the potential to be applied in both whole and skim milk without the need to add salt, a clear advantage over the whole endolysin LysGH15. However, the lytic effect of CHAPLysGH15 in milk was worse than that of LysH5 (cfu from 106 to 0 after 4 h of incubation at 37°C;
      • Obeso J.M.
      • Martínez B.
      • Rodríguez A.
      • García P.
      Lytic activity of the recombinant staphylococcal bacteriophage PhiH5 endolysin active against Staphylococcus aureus in milk.
      ), and it did not completely eliminate S. aureus. This may be related to the structure and source of endolysin. Nevertheless, we provide a new strategy that is not limited to the use of endolysin; instead, according to the structure and function of the enzyme, part of it can still exhibit lytic activity.

      CONCLUSIONS

      Staphylococcus aureus is a severe threat to public health, raising serious concerns. Simultaneously, the prevention of pathogen growth in low-salt foods under nonacidic conditions has been an issue in industry. To date, various methods are being exploited to cope with these problems. Although endolysin is a promising substitute for antibiotics, its development and application in food are still in their infancy. In this work, NaCl was found to have the ability to affect the binding capacity of endolysin. The LysGH15 killed S. aureus in whole and skim milk with the addition of NaCl. However, considering the low salt concentration of milk and the lack of dependence of CHAPLysGH15 on salt, CHAPLysGH15 is more suitable for use as an antimicrobial agent to control S. aureus in dairy products. Moreover, this work provides a new perspective on the application of endolysin in food products; that is, based on the distinct characteristics of whole endolysin and its catalytic domain, either option can be specifically selected in food safety control systems.

      ACKNOWLEDGMENTS

      The authors gratefully acknowledge the financial support provided by the National Key Research and Development Program of China (2017YFC1601704), the National Natural Science Foundation of China (31522044, 31671909, 31772034, and 31901630), the Program of Jiangsu Key Laboratory of Advanced Food Manufacturing Equipment and Technology (FMZ201904; China), the National First-class Discipline Program of Food Science and Technology (JUFSTR20180205; China), the Natural Science Foundation of Jiangsu Province-Youth Program (BK20190583; China), the Fundamental Research Funds for the Central Universities (JUSRP12007; China), and Postgraduate Research and Practice Innovation Program of Jiangsu Provence (KYCX18_1762; China). The authors declare no conflict of interest.

      REFERENCES

        • Bennett S.D.
        • Walsh K.A.
        • Gould L.H.
        Foodborne disease outbreaks caused by Bacillus cereus, Clostridium perfringens, and Staphylococcus aureus—United States, 1998–2008.
        Clin. Infect. Dis. 2013; 57 (23592829): 425-433
        • Bergdoll M.S.
        Staphylococcus aureus. In Foodborne Bacterial Pathogens.
        CRC Press, New York, NY1989
        • Carr A.L.
        • Daley M.J.
        • Givens Merkel K.
        • Rose D.T.
        Clinical utility of methicillin-resistant staphylococcus aureus nasal screening for antimicrobial stewardship: A review of current literature.
        Pharmacotherapy. 2018; 38 (30300441): 1216-1228
        • Castro-Gómez M.P.
        • Rodriguez-Alcalá L.M.
        • Calvo M.V.
        • Romero J.
        • Mendiola J.A.
        • Ibañez E.
        • Fontecha J.
        Total milk fat extraction and quantification of polar and neutral lipids of cow, goat, and ewe milk by using a pressurized liquid system and chromatographic techniques.
        J. Dairy Sci. 2014; 97 (25200790): 6719-6728
        • Chang Y.
        • Kim M.
        • Ryu S.
        Characterization of a novel endolysin LysSA11 and its utility as a potent biocontrol agent against Staphylococcus aureus on food and utensils.
        Food Microbiol. 2017; 68 (28800818): 112-120
        • Cockerill F.R.
        • Wiker M.A.
        • Alder J.
        • Dudley M.N.
        • Eliopoulos G.M.
        • Ferraro M.J.
        • Hardy D.J.
        • Hecht D.W.
        • Hindler J.A.
        • Patel J.B.
        Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically.
        Approved Standard–Ninth Edition. Volume 32. Clinical and Laboratory Standards Institute, Wayne, PA2012
        • Filatova L.Y.
        • Becker S.C.
        • Donovan D.M.
        • Gladilin A.K.
        • Klyachko N.L.
        LysK, the enzyme lysing Staphylococcus aureus cells: Specific kinetic features and approaches towards stabilization.
        Biochimie. 2010; 92 (20144680): 507-513
        • Filatova L.Y.
        • Donovan D.M.
        • Ishnazarova N.T.
        • Foster-Frey J.A.
        • Becker S.C.
        • Pugachev V.G.
        • Balabushevich N.G.
        • Dmitrieva N.F.
        • Klyachko N.L.
        A chimeric LysK-Lysostaphin fusion enzyme lysing Staphylococcus aureus cells: A study of both kinetics of inactivation and specifics of interaction with anionic polymers.
        Appl. Biochem. Biotechnol. 2016; 180 (27168405): 544-557
        • Froger A.
        • Hall J.E.
        Transformation of plasmid DNA into E. coli using the heat shock method.
        J. Vis. Exp. 2007; 2007 (18997900): 253
        • García P.
        • Martínez B.
        • Rodríguez L.
        • Rodríguez A.
        Synergy between the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized milk.
        Int. J. Food Microbiol. 2010; 141 (20537744): 151-155
        • Gu J.
        • Feng Y.
        • Feng X.
        • Sun C.
        • Lei L.
        • Ding W.
        • Niu F.
        • Jiao L.
        • Yang M.
        • Li Y.
        • Liu X.
        • Song J.
        • Cui Z.
        • Han D.
        • Du C.
        • Yang Y.
        • Ouyang S.
        • Liu Z.J.
        • Han W.
        Structural and biochemical characterization reveals LysGH15 as an unprecedented “EF-hand-like” calcium-binding phage lysin.
        PLoS Pathog. 2014; 10 (24831957)e1004109
        • Gu J.
        • Xu W.
        • Lei L.
        • Huang J.
        • Feng X.
        • Sun C.
        • Du C.
        • Zuo J.
        • Li Y.
        • Du T.
        • Li L.
        • Han W.
        LysGH15, A novel bacteriophage lysin, protects a murine bacteremia model efficiently against lethal methicillin-resistant Staphylococcus aureus infection.
        J. Clin. Microbiol. 2011; 49 (21048011): 111-117
        • Helmenstine A.M.
        “What Is the Acidity or pH of Milk?”.
        ThoughtCo, 2020
        • Horgan M.
        • O'Flynn G.
        • Garry J.
        • Cooney J.
        • Coffey A.
        • Fitzgerald G.F.
        • Ross R.P.
        • McAuliffe O.
        Phage lysin LysK can be truncated to its CHAP domain and retain lytic activity against live antibiotic-resistant staphylococci.
        Appl. Environ. Microbiol. 2009; 75 (19047377): 872-874
        • Kadariya J.
        • Smith T.C.
        • Thapaliya D.
        Staphylococcus aureus and staphylococcal food-borne disease: An ongoing challenge in public health.
        BioMed Res. Int. 2014; 2014 (24804250)827965
        • Loeffler J.M.
        • Nelson D.
        • Fischetti V.A.
        Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase.
        Science. 2001; 294 (11739958): 2170-2172
        • Loessner M.J.
        • Kramer K.
        • Ebel F.
        • Scherer S.
        C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates.
        Mol. Microbiol. 2002; 44 (11972774): 335-349
        • Mao J.
        • Schmelcher M.
        • Harty W.J.
        • Foster-Frey J.
        • Donovan D.M.
        Chimeric Ply187 endolysin kills Staphylococcus aureus more effectively than the parental enzyme.
        FEMS Microbiol. Lett. 2013; 342 (23413880): 30-36
        • Marrack P.
        • Kappler J.
        The staphylococcal enterotoxins and their relatives.
        Science. 1990; 248 (2185544): 705-711
        • Obeso J.M.
        • Martínez B.
        • Rodríguez A.
        • García P.
        Lytic activity of the recombinant staphylococcal bacteriophage PhiH5 endolysin active against Staphylococcus aureus in milk.
        Int. J. Food Microbiol. 2008; 128 (18809219): 212-218
        • Park Y.H.
        • Seo K.S.
        • Ahn J.S.
        • Yoo H.S.
        • Kim S.P.
        Evaluation of the petrifilm plate method for the enumeration of aerobic microorganisms and coliforms in retailed meat samples.
        J. Food Prot. 2001; 64 (11726171): 1841-1843
        • Reich P.J.
        • Boyle M.G.
        • Hogan P.G.
        • Johnson A.J.
        • Wallace M.A.
        • Elward A.M.
        • Warner B.B.
        • Burnham C.-A.D.
        • Fritz S.A.
        Emergence of community-associated methicillin-resistant Staphylococcus aureus strains in the neonatal intensive care unit: An infection prevention and patient safety challenge.
        Clin. Microbiol. Infect. 2016; 22 (27126609): 645.e1-645.e8
        • Romero P.
        • Bartual S.G.
        • Schmelcher M.
        • Glück C.
        • Hermoso J.A.
        • Loessner M.J.
        Structural insights into the binding and catalytic mechanisms of the Listeria monocytogenes bacteriophage glycosyl hydrolase PlyP40.
        Mol. Microbiol. 2018; 108 (29405497): 128-142
        • Schmelcher M.
        • Korobova O.
        • Schischkova N.
        • Kiseleva N.
        • Kopylov P.
        • Pryamchuk S.
        • Donovan D.M.
        • Abaev I.
        Staphylococcus haemolyticus prophage ΦSH2 endolysin relies on cysteine, histidine-dependent amidohydrolases/peptidases activity for lysis ‘from without'.
        J. Biotechnol. 2012; 162 (23026556): 289-298
        • Son B.
        • Yun J.
        • Lim J.A.
        • Shin H.
        • Heu S.
        • Ryu S.
        Characterization of LysB4, an endolysin from the Bacillus cereus-infecting bacteriophage B4.
        BMC Microbiol. 2012; 12 (22416675): 33
        • Turck D.
        Cow's milk and goat's milk.
        World Rev. Nutr. Diet. 2013; 108 (24029787): 56-62
        • Wakabayashi Y.
        • Umeda K.
        • Yonogi S.
        • Nakamura H.
        • Yamamoto K.
        • Kumeda Y.
        • Kawatsu K.
        Staphylococcal food poisoning caused by Staphylococcus argenteus harboring staphylococcal enterotoxin genes.
        Int. J. Food Microbiol. 2018; 265 (29112896): 23-29