Advertisement

Cloning, expression, and bioinformatics analysis and characterization of a β-galactosidase from Bacillus coagulans T242

Open ArchivePublished:January 14, 2021DOI:https://doi.org/10.3168/jds.2020-18942

      ABSTRACT

      The activities of β-galactosidases from bacteria and molds are affected by temperature, pH, and other factors in the processing of dairy products, limiting their application, so it is necessary to find alternative lactases. In this study, the β-galactosidase gene from Bacillus coagulans T242 was cloned, co-expressed with a molecular chaperone in Escherichia coli BL21, and subjected to bioinformatic and kinetic analyses and lactase characterization. The results show that the enzyme is a novel thermostable neutral lactase with optimum hydrolytic activity at pH 6.8 and 50°C. The thermal stability and increased lactose hydrolysis activity of β-galactosidase in the presence of Ca2+ indicated its potential application in the dairy industry.

      Key words

      INTRODUCTION

      β-Galactosidase (EC 3.2.1.23), also known as lactase, is an enzyme that catalyzes the hydrolysis of nonreducing β-d-galactose units at the terminus of β-d-galactoside (
      • Rico-Díaz A.
      • Álvarez-Cao M.E.
      • Escuder-Rodríguez J.J.
      • González-Siso M.I.
      • Cerdán M.E.
      • Becerra M.
      Rational mutagenesis by engineering disulphide bonds improves Kluyveromyces lactis beta-galactosidase for high-temperature industrial applications open.
      ). The development of β-galactosidase for use in food, medicine, and other aspects is necessary, showing good prospects, such as use as a food additive for sweetness and avoidance of freezing crystallization (
      • Ken-ichi I.
      • Sumie Y.
      • Yasushi T.
      The effects of additives on the stability of freeze-dried β-galactosidase stored at elevated temperature.
      ), application as a lactase preparation for patients with lactose intolerance (
      • Lin M.Y.
      • Dipalma J.A.
      • Martini M.C.
      • Gross C.J.
      • Harlander S.K.
      • Savaiano D.A.
      Comparative effects of exogenous lactase (β-galactosidase) preparations on in vivo lactose digestion.
      ), use in feeds for animals (
      • Yiğit N.O.
      • Koca S.B.
      • Didinen B.I.
      • Diler I.
      Effect of β-mannanase and α-Galactosidase supplementation to soybean meal based diets on growth, feed efficiency and nutrient digestibility of rainbow trout, Oncorhynchus mykiss (Walbaum).
      ), and use in the production of galactose oligosaccharides (
      • Carević M.
      • Ćorović M.
      • Mihailović M.
      • Banjanac K.
      • Milisavljević A.
      • Veličković D.
      • Bezbradica D.
      Galacto-oligosaccharide synthesis using chemically modified β-galactosidase from Aspergillus oryzae immobilised onto macroporous amino resin.
      ). At present, β-galactosidases are also used for the hydrolysis of lactose in the dairy industry to develop low-lactose or free-lactose dairy products (
      • Ugidos-Rodríguez S.
      • Matallana-González M.C.
      • Sánchez-Mata M.C.
      Lactose malabsorption and intolerance: A review.
      ) for people with lactose intolerance, enabling remission of clinical responses.
      β-Galactosidases exist widely in animals, plants, and microorganisms (
      • Wen F.
      • Celoy R.
      • Price I.
      • Ebolo J.J.
      • Hawes M.C.
      Identification and characterization of a rhizosphere β-galactosidase from Pisum sativum L.
      ). Because of the rapid growth, rapid metabolism, and other excellent biological characteristics of these microorganisms, microbial-derived β-galactosidases have the advantages of being abundant, diverse, inexpensive, and produced via a short production cycle (
      • Bilal M.
      • Iqbal H.M.
      State-of-the-art strategies and applied perspectives of enzyme biocatalysis in food sector—Current status and future trends.
      ). Most β-galactosidases are produced by bacteria, yeasts, and molds (
      • Shen L.M.
      • Gu Q.M.
      • Li Y.T.
      • Fang S.
      • Gao S.
      Basic Biochemistry.
      ), and commercialized β-galactosidases are derived mainly from yeasts and molds (
      • Gekas V.
      • Lopez-Leiva M.
      Hydrolysis of lactose: A literature review.
      ). Among these enzymes, the optimum reaction pH of yeast lactases is similar to that of milk, making these enzymes suitable for use with fresh milk. However, these lactases are intracellular enzymes, and their optimum reaction temperature is approximately 37°C. At this temperature, lactose in dairy products is hydrolyzed slowly by yeast lactases, such as the lactase of Kluyveromyces marxianus with a Michaelis constant (Km) of 4 mM (
      • O'Connell S.
      • Walsh G.
      Purification and properties of a β-galactosidase with potential application as a digestive supplement.
      ) and the lactase Kluyveromices fragilis with Km of 4.6 mM (
      • Santos A.
      • Ladero M.
      • Garcıa-Ochoa F.
      Kinetic modeling of lactose hydrolysis by a β-galactosidase from Kluyveromices fragilis.
      ). However, to hydrolyze most of the lactose in whey, a Km of at least 10 mM is probably required. In particular, a high Km would result in less residual lactose and thus fewer issues with subsequent microbial spoilage (
      • Lind D.L.
      • Daniel R.M.
      • Cowan D.A.
      • Morgan H.W.
      β-Galactosidase from a strain of the anaerobic thermophile, Thermoanaerobacter.
      ). Mold lactases are extracellular enzymes, and their optimum reaction temperature is higher than 50°C; however, they are acid stable, and their optimum reaction pH is acidic (
      • Gekas V.
      • Lopez-Leiva M.
      Hydrolysis of lactose: A literature review.
      ), so they are used only in acid whey and cheese processing.
      Many β-galactosidases from thermophilic bacteria are thermophilic, which have the advantages of a neutral optimum reaction pH and fast reaction speed. To reduce bacterial contamination, lactose hydrolysis at high temperatures (above the temperature of pasteurization) seems to have some obvious advantages, so thermostable β-galactosidases are compatible with pasteurization and reduce the risk of contamination during milk production (
      • Lind D.L.
      • Daniel R.M.
      • Cowan D.A.
      • Morgan H.W.
      β-Galactosidase from a strain of the anaerobic thermophile, Thermoanaerobacter.
      ), and do not share the shortcomings of the enzymes from mold and yeast. Thus, these β-galactosidases have attracted much attention in dairy production.
      At present, most bacterial-derived β-galactosidases are mesophilic enzymes (
      • Craven G.R.
      • Steers E.
      • Anfinsen C.B.
      Purification, composition, and molecular weight of the β-D-galactosidase of Escherichia coli k12.
      ;
      • Kim J.W.
      • Rajagopal S.N.
      Isolation and characterization of β-galactosidase from Lactobacillus crispatus.
      ;
      • Santibáñez L.
      • Fernández-Arrojo L.
      • Guerrero C.
      • Plou F.J.
      • Illanes A.
      Removal of lactose in crude galacto-oligosaccharides by β-galactosidase from Kluyveromyces lactis.
      ), and the optimum reaction temperatures of these enzymes have been reported to be less than 50°C. The poor thermal resistance of β-galactosidase limits its application in dairy products since the lowest pasteurization temperature is 60°C. Hence, the acquisition of thermostable β-galactosidases has attracted much attention, by means of natural source screening, enzyme engineering, and so on. In 1998, an extreme thermostable β-galactosidase derived from Thermus sp. A4, which was isolated from a hot spring, showed an optimum reaction temperature of 70°C (
      • Ohtsu N.
      • Motoshima H.
      • Goto K.
      • Tsukasaki F.
      • Matsuzawa H.
      Thermostable β-galactosidase from an extreme thermophile, thermus sp. A4: Enzyme purification and characterization, and gene cloning and sequencing.
      ). In recent years, some thermally stable β-galactosidases from Bacillus coagulans have been reported.
      • Batra N.
      • Singh J.
      • Banerjee U.C.
      • Patnaik P.R.
      • Sobti R.C.
      Production and characterization of a thermostable beta-galactosidase from Bacillus coagulans RCS3.
      reported that the optimum reaction temperature of a β-galactosidase from the hot springs–originated Bacillus coagulans RCS3 was 50°C; additionally,
      • Liu P.
      • Xie J.
      • Liu J.
      • Ouyang J.
      A novel thermostable β-galactosidase from Bacillus coagulans with excellent hydrolysis ability for lactose in whey.
      purified the expressed β-galactosidase from Bacillus coagulans NL01, and its optimum reaction temperature was 55 to 60°C.
      In this study, we reported the gene isolation, sequence analysis, and characterization of a thermostable β-galactosidase from Bacillus coagulans T242 (the β-galactosidase in this study was abbreviated as T242BgaB). Preliminary bioinformatics analysis and functional property characterization of the enzyme were performed, providing a reference for its future development and utilization.

      MATERIALS AND METHODS

      Strains, Vectors, and Media

      Bacillus coagulans T242 is a bacterium that was isolated from a fermentation pond of a condiment factory in Dalian; preserved in the Dalian Key Laboratory of Functional Probiotics, Dalian Polytechnic University, China; and used for genomic DNA extraction.
      Escherichia coli HST08 (TaKaRa Biotechnology, Dalian, China) and pET-32a(+) (TaKaRa Biotechnology) were used as host vector systems for gene cloning and DNA sequencing. Escherichia coli BL21, pET-32a(+) (TaKaRa Biotechnology), and pGro7 (molecular chaperone; Novagen, Beijing, China) were used for construction and sequencing of the recombinant expression plasmid.
      Bacillus coagulans T242 was grown in fermentation medium (2% lactose, 1.5% peptone, 0.5% yeast extract, 0.5% MgSO4, natural pH). The expression of the β-galactosidase gene was performed in LB/Amp medium [Luria-Bertani medium, 100 μg·mL−1 ampicillin (Sigma, St. Louis, MO), pH 7.0]. Soluble expression of the β-galactosidase gene was achieved in LB/Amp/Cm medium (Luria-Bertani medium, 100 μg·mL−1 ampicillin, 34 μg·mL−1 chloromycetin; Sigma, pH 7.0;
      • Samiee M.
      • Kohnehrouz B.B.
      • Norouzi M.
      Cloning and bioinformatics analysis of accD gene from bell pepper (Capsicum annuum).
      ).

      Genomic DNA Extraction

      Bacillus coagulans T242 was cultured in the above-mentioned fermentation medium on a rotary incubator (200 × g) at 30°C for 20 h until it reached the exponential phase. One milliliter of bacterial solution was taken and centrifuged at 8,800 × g at room temperature for 10 min. The bacteria were collected and washed thoroughly with deionized water. Extraction of Bacillus coagulans T242 genomic DNA was performed according to a TaKaRa Mini BEST Bacterial Genomic DNA Purification Kit (TaKaRa Biotechnology). The extracted genomic DNA was dissolved in Tris-EDTA buffer (
      • Bruno J.G.
      • Sivils J.C.
      Studies of DNA aptamer OliGreen and PicoGreen fluorescence interactions in buffer and serum.
      ) for use. Genomic DNA purity was tested by spectrophotometry [optical density (OD) at 260 nm/OD at 280 nm)].

      PCR Primers

      The sequence of the lactase gene from Bacillus coagulans 36D1 reported in GenBank was used as the reference sequence (the lactase gene of Bacillus coagulans 36D1 has not been verified, but it is predicted to be the lactase gene according to the open reading frames), and Bacillus coagulans T242 genomic DNA was used as the template for PCR verification. Two pairs of primers used, F1/R1 and F2/R2, were designed, and the results were confirmed with 3% agarose gel electrophoresis.
      The following primers were designed to determine the sequence of the lactase gene. The forward (F)/reverse (R) primers were designed based on the reference sequence, and EcoRI and XhoI restriction sites were introduced at the 5′ terminus of the 2 primers. According to the 36D1 genomic DNA (GenBank accession number: NC_016023.1), 2 pairs of primers, F3/R3 and F4/R4, were designed upstream of the initial codon and downstream of the termination codon of the lactase gene. Concurrently, primer F5 was designed approximately 100 bp downstream of the initial codon of the reference sequence. All PCR primers (except those provided by kits), as listed in Table 1, were synthesized by TaKaRa (TaKaRa Biotechnology).
      Table 1Sequences of the primers used for PCR
      Primer
      F = forward; R = reverse.
      Sequence (5′–3′)Size (bp)
      FGAATTCATGTTAAAAAAACAAGAAAAA27
      RCTCGAGCTATTTTTCAATTACCTG C25
      F1TGCCGAATGCTACTGCGACA20
      R1GCAGCCGCTTCATAACTCCA20
      F2GTGTATCTTGGCGGCTATCC20
      R2GAGCCGGACCGTTTCTGATT20
      F3GGACAACTTGGAGGAATACG20
      R3AAGGGCAGTTTTCCAATCCG20
      F4GGAAACATTGGGTGGCAGTG20
      R4TGGAGTAGGCAAAGGGCAGT20
      F5GAAAGAAGACATGCGGCTGA20
      T7TAATACGACTCACTATAGGG20
      SRAACGCTGGCTCCAGAAGTCCGT22
      1 F = forward; R = reverse.
      Colonies were randomly selected, and the universal primers BcaBEST Primer T7 and Primer SR were used for PCR (the primers were designed according to the known sequence, and the DNA fragment was approximately 1 kb). The amplified products were detected by 1% agarose gel electrophoresis; the colonies consistent with the expected results were considered positive clones, which were cultured, and the plasmids were extracted for sequencing.

      Target Gene Cloning

      The amplified DNA fragments of F1/R1 and F2/R2 were localized on the reference sequence, and the cloned regions could not completely cover the entire lactose gene and their sizes were approximately 500 bp (Figure 1), so the complete lactase gene could not be amplified. Furthermore, the amplified DNA fragments of F/R, F3/R3, and F4/R4 were analyzed, and they all contained the enzyme gene (Figure 1), but no amplification product was observed through agarose gel electrophoresis. Therefore, these primers (F1/R1, F2/R2, F/R, F3/R3, and F4/R4) were recombined to ultimately yield the enzyme gene.
      Figure thumbnail gr1
      Figure 1Schematic diagram of primer-binding sites. The DNA fragments amplified with F1/R1 and F2/R2 were located between 1–1,000 bp and 1,000–2,000 bp of the reference sequence (the gray strip), respectively; the DNA fragments amplified with the primers F/R, F3/R3, and F4/R4 all contained the enzyme gene. F = forward; R = reverse.
      The templates were amplified with PCR using primer pairs (Table 2), and primer F5/R1 was used to test the homology between the lactase gene of the experimental strain and the reference sequence to determine the PCR primers. The target gene (bgaB) was amplified by PCR with PrimeSTAR HS DNA Polymerase, and amplification products were detected by 1% agarose gel electrophoresis, purified (Agarose Gel DNA Purification Kit Ver. 2.0) and analyzed (TaKaRa Biotechnology).
      Table 2Primer pairs and PCR conditions
      GroupPrimer pairs
      F = forward; R = reverse.
      Size (bp)PCR conditions
      IF3/R1~1,000Initial denaturation at 92°C for 2 min; 30 cycles of 98°C for 10 s, 57°C for 30 s, and 72°C for 1 min; and final elongation at 72°C for 2 min
      F4/R1~1,000
      F5/R1~900
      F2/R3~550
      F2/R4~550
      IIF3/R~2,000Initial denaturation at 92°C for 2 min; 30 cycles of 98°C for 10 s, 47°C for 30 s, and 72°C for 2 min; and final elongation at 72°C for 5 min
      F4/R~2,000
      IIIF3/R3~1,900Initial denaturation at 92°C for 2 min; 30 cycles of 98°C for 10 s, 57°C for 30 s, and 72°C for 2 min; and final elongation at 72°C for 5 min
      F3/R4~2,000
      1 F = forward; R = reverse.
      According to the operational instructions of the DNA Ligation Kit < Mighty Mix > (TaKaRa Biotechnology), bgaB was linked to pET-32a(+) (Figure 2). Then, pET32-bgaB was transformed into E. coli HST08 and cloned. Finally, the plasmids were extracted from the positive clones and sequenced.
      Figure thumbnail gr2
      Figure 2Construction of the expression pET32-gal vector. The lactase gene expression plasmid was pET32, and the gene was located between the XhoI and EcoRI sites of the plasmid.

      Analysis of Amino Acid and DNA Sequences

      The nucleotide sequence of the bgaB gene was uploaded to the National Center for Biotechnology Information GenBank. The T242 BgaB amino acid sequence was uploaded to the online server ProtParam (http://web.expasy.org/protparam/;
      • Garg V.K.
      • Avashthi H.
      • Tiwari A.
      • Jain P.A.
      • Ramkete P.W.R.
      • Kayastha A.M.
      • Singh V.K.
      MFPPI-multi FASTA ProtParam interface.
      ) to predict its properties: residue composition, length, and theoretical isoelectric point. The signal peptide, hydrophobicity, family, transmembrane region, and subcellular localization were predicted by SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/), ProtScale (http://web.expasy.org/protscale/), Pfam (http://pfam.xfam.org/), TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/;
      • Seddigh S.
      Comprehensive comparison of two protein family of P-ATPases (13A1 and 13A3) in insects.
      ), and PSORTb version 3.0.2 (http://www.psort.org/psortb/;
      • Whitlock G.C.
      • Robida M.D.
      • Judy B.M.
      • Omar Q.
      • Brown K.A.
      • Arpaporn D.
      • Katherine T.
      • Shane M.
      • Andrey L.
      • Borovkov A.Y.
      Protective antigens against glanders identified by expression library immunization.
      ), respectively. The T242 BgaB amino acid sequence was aligned with other β-galactosidase sequences in the protein database to determine its family and amino acid conservation. The PyMOL software (PyMOL Molecular Graphics System, Version 2.0, Schrödinger LLC; https://pymol.org/2/) was employed to model and annotate the 3-dimensional protein structures.

      Transformation and Expression of the bgaB Gene

      Three vectors (the expression plasmid pET32-bgaB, the empty vector pET-32a(+) and both the expression plasmid pET32-bgaB and molecular chaperone plasmid pGro7) were introduced separately into E. coli BL21 to prepare recombinant systems. After bacterial growth, the recombinant bacteria were inoculated into 6 mL of LB/Amp/Cm medium at 2% and cultured at 200 × g at 37°C for 2 min, until the OD600 was approximately 0.6. At this time, isopropyl β-d-1-thiogalactopyranoside (IPTG; final concentration 1 mM) was added into the above bacterial solution, which was then incubated for 4 h. Then, the OD600 of the recombinant bacterial solution was adjusted to approximately 1.0 with PBS [pH 7.0, 0.1 M PBS, 0.15% Triton X-100 (Sigma-Aldrich, St. Louis, MO)], and an appropriate amount of the diluted bacterial solution was taken for centrifugation (13,500 × g, 2 min, and 4°C). The precipitate was resuspended in 200 μL of PBS for ultrasound lysis (200 W, 9 s/6 s, and 15 cycles) on ice, and 100 μL of the lysed cell solution was centrifuged for 10 min. The supernatant was stored at 4°C, and the precipitate was resuspended in 100 μL of PBS. The lysed cell solution, the supernatant, and the resuspension described above were used as samples for SDS-PAGE analysis.

      Purification of T242 BgaB

      As described above, gene expression was induced by IPTG, and the E. coli BL21 precipitate was collected after centrifugation. The precipitate was thoroughly washed with Tris-HCl buffer (pH 7.9) for ultrasound lysis, and the supernatant obtained by centrifugation was the crude β-galactosidase solution.
      Because histidine-tagged β-galactosidase in crude enzyme solution can be eluted by imidazole at high concentrations (
      • Wanarska M.
      • Kur J.
      • Pladzyk R.
      • Turkiewicz M.
      Thermostable Pyrococcus woesei β-D-galactosidase–High level expression, purification and biochemical properties.
      ), T242 BgaB could be purified by Ni-NTA affinity chromatography. The lactase purity was analyzed by 10% SDS-PAGE, and the soluble protein content was determined (
      • Peterson G.L.
      Review of the Folin phenol protein quantitation method of Lowry, Rosebrough, Farr and Randall.
      ).

      Characterization of the Hydrolytic Ability of T242 BgaB

      The lactose hydrolytic activity of T242 BgaB was determined by referring to the determination method of β-galactosidase activities from Aspergillus oryzae and Aspergillus niger (
      • National Standard of the People's Republic of China
      GB/T 33409–2016. Determination of the activity of beta-galactosidase-Spectrophotometric method.
      ). The reaction was performed with 5.0 mL of 2.500 mg·mL−1 2-nitrophenyl β-d-galactopyranoside (ONPG; in 50 mM PBS, pH 6.8) and 1.0 mL of enzyme at the measured temperature for 10 min, and the ONPG and enzyme were preincubated for 15 min at the measured temperature. One unit of hydrolytic activity was defined as the amount of the enzyme that catalyzes 1 μmol of ONPG to o-nitrophenol in 1 min under the assay conditions.
      The optimum reaction temperature was determined as the relative activity at the different temperatures (37–65°C) at pH 6.8, and the responses were expressed as the relative activity (%), with the highest enzymatic activity considered 100%. To analyze thermal stability, the enzyme was incubated at different reaction temperatures (the optimum reaction temperature ± 5°C) for 100 min, and the residual activity of the enzyme was measured every 20 min.
      The optimum reaction pH was determined as the relative activity at the optimum reaction temperature at different pH values (3.0–9.0; citric acid-sodium citrate buffer was used when the pH was less than 5, KH2PO4-NaOH buffer was used when the pH was 5–8, and glycine-sodium hydroxide buffer was used when the pH was greater than 8), and the responses were expressed as the relative activity (%), with the highest enzymatic activity considered 100%. To analyze the pH stability, the residual enzyme activity was measured after incubation at different pH values for 1 h at room temperature.
      To study the effect of different metal ions on T242 BgaB activity, various metal ions (Cu2+, Mg2+, Ca2+, Zn2+, Mn2+, Fe2+, K+, and Na+) were added into the enzyme solution (50 mM PBS, pH 6.8). Mixed enzyme solutions with different metal ions were made, and the final concentration of metal ions was 1 mM. The enzyme activity was measured at 50°C, and the enzymatic activity was expressed as the relative activity (%) with 100% activity occurring without any metallic salt.
      Under the optimum conditions, the enzymatic reaction rates at different concentrations (2–10 mM) of ONPG were determined, and the Km and Vmax of T242 BgaB were calculated according to the Lineweaver-Burk plot method (
      • Aynacı E.
      • Sarı N.
      • Tümtürk H.
      Immobilization of β-galactosidase on novel polymers having Schiff bases.
      ).

      Statistical Analyses

      All experiments were repeated 3 times, and the analysis was performed at least in triplicate. Differences between the means of multiple groups were analyzed by ANOVA with Duncan's multiple range tests at P < 0.05, and the data are expressed as the mean or mean ± standard deviation using SPSS 18.0 software (SPSS Inc., Chicago, IL) and Origin 85 software (Microsoft Corporation, Redmond, WA).

      RESULTS

      Cloning of the Lactase Gene bgaB

      Using B. coagulans T242 genomic DNA as a template, primers F1/R1 and F2/R2 generated products of approximately 500 bp (Figure 3A). As expected, the products had high homology with the reference sequence. Theoretically, the lactase gene can be obtained by amplification with the F/R primers that were designed according to the reference sequence (the lactase gene from 36D1), but no DNA band was detected by agarose gel electrophoresis (not shown in the figure). The reasons for this result may be that the base composition of the upstream primer F was inappropriate and that the A/T content was high, which prevented specific primer and template binding from proceeding at the low annealing temperature.
      Figure thumbnail gr3
      Figure 3Determination of PCR primers and methods. After primer recombination and PCR, it was confirmed that the Bacillus coagulans T242 β-galactosidase (T242 BgaB) gene was amplified by subcloning (F3/R and F/R). M1 = DL2000 (100–2,000 bp); M2 = λ-HindIII digest (2.0–23.1 kbp); S1–S2 = PCR products of F1/R1 and F2/R2; S3–S7 = PCR products of F3/R1, F4/R1, F5/R1, F2/R3, and F2/R4; S8–S11 = PCR products of F4/R, F3/R, F2/R4, and F2/R3; S12–S14 = PCR products F3/R, F4/R, and F2/R; S15 = PCR products of F/R. F = forward; R = reverse.
      In addition, no DNA fragments were amplified by the primers (F3/R3 and F4/R4) designed based on the 36D1 genomic DNA sequence (not shown in the figure), which may be due to the low homology between the genomes of the experimental strains T242 and 36D1 in this relevant region and the lack of primer-specific binding sites on the T242 genomic DNA.
      Therefore, the primers mentioned above were recombined for PCR, and the target gene was cloned progressively. In Figure 3B, the molecular masses of the main amplified products of F3/R1, F4/R1, F5/R1, F2/R3, and F2/R4 were lower than the theoretical value of the lactase gene (approximately 2.0 kbp). Therefore, these recombined primer pairs were deemed unsuitable for amplification. In Figure 3C, an approximately 2 kbp DNA fragment, which could contain target genes, was detected in both S8 (F3/R) and S9 (F4/R) by electrophoresis. After that, F3, F4, R, and PrimeSTAR HS DNA Polymerase were used to amplify the DNA fragments again to reduce the base mutations in the PCR products, and we obtained an approximately 2-kbp DNA fragments (Figure 3D, in S12 and S13), which was consistent with the results for S8 and S9. However, the main amplification products in S13 were not the only products observed, so the F4/R primer pair was not conducive to the amplification of the lactase gene. It was therefore determined that the primer F3/R was able to successful amplify the target lactase gene.
      Based on the above results, the target gene was extracted by subcloning to ensure the PCR accuracy. The β-galactosidase of T242 was first amplified by F3/R, and the obtained products were used as the PCR template to amplify the target gene with F/R (Figure 3E). The final products were confirmed to be the lactase gene after sequencing.
      Finally, the lactase gene bgaB was inserted into the pET-32a(+) vector and transformed into E. coli HST08 for cloning, and the positive clones were screened by colony PCR and plasmid sequencing to confirm gene presence.

      Analysis of Amino Acid and DNA Sequences

      The thermostable β-galactosidase gene from Bacillus coagulans T242 was cloned and sequenced (GenBank accession number: JQ388474.1). Bioinformatics analysis revealed that the open reading frames of the β-galactosidase gene were 1,998 bp with 48.5% G-C content, which was consistent with the electrophoretic band (Figure 3E). The gene encoded an enzyme of 665 amino acids, of which nonpolar amino acids accounted for 42.9%, with a theoretical molecular mass of 76.09 kDa and a theoretical pI of 6.06. According to the amino acid composition analysis, we predicted that the β-galactosidase was a hydrophilic intracellular protein (in the cytoplasm) without transmembrane regions or signal peptides and that it belonged to the GH-42 family. Interestingly, β-galactosidases of the GH-42 family are stable in extreme circumstances, such as thermophilic, psychrotrophic, halophilic, and acidophilic conditions (
      • Dong Y.N.
      • Liu X.M.
      • Chen H.Q.
      • Xia Y.
      • Zhang H.P.
      • Zhang H.
      • Chen W.
      Enhancement of the hydrolysis activity of β-galactosidase from Geobacillus stearothermophilus by saturation mutagenesis.
      ). This stability is attributed to the fact that the GH-42 family enzymes from Eubacteria, Archaea, and Eukaryota are isolated from extremophiles, including psychrophilic and thermophilic microorganisms. Understanding the properties of these enzymes is particularly useful for investigation of molecular strategies of thermal adaptation (
      • Mangiagalli M.
      • Lapi M.
      • Maione S.
      • Orlando M.
      • Brocca S.
      • Pesce A.
      • Barbiroli A.
      • Camilloni C.
      • Pucciarelli S.
      • Lotti M.
      • Nardini M.
      The co-existence of cold activity and thermal stability in an Antarctic GH42 β-galactosidase relies on its hexameric quaternary arrangement.
      ).
      The amino acid sequence of T242 BgaB was compared with the amino acid sequence of other proteins in the protein database, and only 9 enzymes showed high homology (>30%) with T242 BgaB (Table 3). Eight of them were β-galactosidases and belonged to the GH-42 family, and 3TTS (
      • Maksimainen M.
      • Paavilainen S.
      • Hakulinen N.
      • Rouvinen J.
      Structural analysis, enzymatic characterization, and catalytic mechanisms of β-galactosidase from Bacillus circulans sp. alkalophilus.
      ), 4OJY and 5DFA (
      • Teplitsky A.
      • Feinberg H.
      • Gilboa R.
      • Lapidot A.
      • Mechaly A.
      • Stojanoff V.
      • Capel M.
      • Shoham Y.
      • Shoham G.
      Crystallization and preliminary X-ray analysis of the thermostable alkaline-tolerant xylanase from Bacillus stearothermophilus T-6.
      ;
      • Solomon H.V.
      • Tabachnikov O.
      • Feinberg H.
      • Govada L.
      • Chayen N.E.
      • Shoham Y.
      • Shoham G.
      Crystallization and preliminary crystallographic analysis of GanB, a GH42 intracellular β-galactosidase from Geobacillus stearothermophilus.
      ), and 1KWG (
      • Ohtsu N.
      • Motoshima H.
      • Goto K.
      • Tsukasaki F.
      • Matsuzawa H.
      Thermostable β-galactosidase from an extreme thermophile, thermus sp. A4: Enzyme purification and characterization, and gene cloning and sequencing.
      ) were thermostable enzymes. Thus, it was predicted that T242 BgaB belonged to the GH-42 family, which was consistent with the Pfam prediction.
      Table 3Homologous enzymes of Bacillus coagulans T242 β-galactosidase and their information
      PDB code
      PDB = Protein Data Bank. 5DFA and 4UOZ are mutants of 4OJY (Solomon et al., 2015) and 4UNI (Viborg et al., 2014), respectively, whose active site residues (Glu) were replaced by Ala via artificial means. 4OIF is a β-glucosidase from an Archaea and belongs to the GH-35 family, so it was not considered in this study.
      TypeFamilySourceHomology (%)
      3TTSβ-GalactosidaseCH-42Bacillus circulans sp. alkalophilus45
      5E9Aβ-GalactosidaseCH-42Rahnella sp. R336
      4UZSβ-GalactosidaseCH-42Bifidobacterium bifidum S1737
      4UNIβ-GalactosidaseCH-42Bifidobacterium animalis ssp. lactis Bl-0437
      4UOZβ-GalactosidaseCH-42Bifidobacterium animalis ssp. lactis Bl-0436
      4OJYβ-GalactosidaseCH-42Geobacillus stearothermophilus T-636
      5DFAβ-GalactosidaseCH-42Geobacillus stearothermophilus T-636
      4OIFβ-GlucosidaseCH-35Archaea36
      1KWGβ-GalactosidaseCH-42Thermus sp. A431
      1 PDB = Protein Data Bank. 5DFA and 4UOZ are mutants of 4OJY (
      • Solomon H.V.
      • Tabachnikov O.
      • Lansky S.
      • Salama R.
      • Feinberg H.
      • Shoham Y.
      • Shoham G.
      Structure–function relationships in Gan42B, an intracellular GH42 b-galactosidase from Geobacillus stearothermophilus.
      ) and 4UNI (
      • Viborg A.H.
      • Fredslund F.
      • Katayama T.
      • Nielsen S.K.
      • Svensson B.
      • Kitaoka M.
      • Lo Leggio L.
      • Hachem M.A.
      A β1–6/β1–3 galactosidase from Bifidobacterium animalis ssp. lactis Bl-04 gives insight into sub-specificities of β-galactoside catabolism within Bifidobacterium.
      ), respectively, whose active site residues (Glu) were replaced by Ala via artificial means. 4OIF is a β-glucosidase from an Archaea and belongs to the GH-35 family, so it was not considered in this study.
      As shown by the phylogenetic tree (Figure 4) of T242 BgaB and the above 8 β-galactosidases, 3TTS, 5E9A, 4OJY, 5DFA, and T242 BgaB were in the same phylogenetic cluster. Compared with T242 BgaB, 5E9A, 4OJY, and 5DFA might have experienced different degrees of evolution, whereas 3TTS experienced a lower degree of evolution, which further suggested that the genetic relationship between T242 BgaB and 3TTS was relatively close and that they might have similar biological functions. Interestingly, T242 BgaB occupied a “leaf node” alone, which might mean that T242 BgaB constitutes the first member of a new branch.
      Figure thumbnail gr4
      Figure 4Phylogenetic tree analysis of Bacillus coagulans T242 β-galactosidase (T242 BgaB;
      • Liò P.
      • Goldman N.
      Models of molecular evolution and phylogeny.
      ). The “leaf nodes” were the Protein Data Bank codes of enzymes (except T242 BgaB). The phylogenetic tree was constructed with the neighbor-joining algorithm method and bootstrapped 10,000 times. The evolutionary distances were computed using the Poisson correction method and are presented in units of the number of amino acid substitutions per site. The above analysis was conducted in MEGA X (
      • Kumar S.
      • Stecher G.
      • Li M.
      • Knyaz C.
      • Tamura K.
      MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms.
      ).
      Based on the known information about 3TTS, the key residues of T242 BgaB associated with lactose hydrolysis were predicted to be E149 and E303. Multiple alignment of the amino acid sequences of T242 BgaB and the above 8 β-galactosidases was performed (Figure 5). For T242 BgaB, the 2 key residues and the amino acid residues around them were highly conserved; thus, we infer that its key residues and hydrolysis mechanism were similar to those of the other 8 β-galactosidases. In GH-42 β-galactosidases, the catalytic center consists of 2 glutamic acid residues, suggesting that the hydrolysis method is a retaining mechanism (
      • Mangiagalli M.
      • Lapi M.
      • Maione S.
      • Orlando M.
      • Brocca S.
      • Pesce A.
      • Barbiroli A.
      • Camilloni C.
      • Pucciarelli S.
      • Lotti M.
      • Nardini M.
      The co-existence of cold activity and thermal stability in an Antarctic GH42 β-galactosidase relies on its hexameric quaternary arrangement.
      ). The 5DFA and 4UOZ are mutants of 4OJY (
      • Solomon H.V.
      • Tabachnikov O.
      • Lansky S.
      • Salama R.
      • Feinberg H.
      • Shoham Y.
      • Shoham G.
      Structure–function relationships in Gan42B, an intracellular GH42 b-galactosidase from Geobacillus stearothermophilus.
      ) and 4UNI (
      • Viborg A.H.
      • Fredslund F.
      • Katayama T.
      • Nielsen S.K.
      • Svensson B.
      • Kitaoka M.
      • Lo Leggio L.
      • Hachem M.A.
      A β1–6/β1–3 galactosidase from Bifidobacterium animalis ssp. lactis Bl-04 gives insight into sub-specificities of β-galactoside catabolism within Bifidobacterium.
      ), respectively, whose active site residues (Glu) were replaced by Ala via artificial means, which leads to the conservation of E303 being less than 100%.
      Figure thumbnail gr5
      Figure 5Conservation of the key residues of Bacillus coagulans T242 β-galactosidase (T242 BgaB). Multiple sequence alignment was accomplished by MEGA X software (
      • Kumar S.
      • Stecher G.
      • Li M.
      • Knyaz C.
      • Tamura K.
      MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms.
      ). The conservation of residues increases with the deepening of the background color. *Key residues of hydrolysis.
      The predicted spatial structure of T242 BgaB is shown in Figure 6. The T242 BgaB is a homotrimer (Figure 6A), and the first domain of each subunit exhibits a triose-phosphate isomerase (TIM) structure (Figure 6B). According to the prediction, each subunit contains 2 catalytic sites that are located in the TIM barrel (Figure 6C).
      Figure thumbnail gr6
      Figure 6The predicted spatial structure of Bacillus coagulans T242 β-galactosidase (T242 BgaB). (A) T242 BgaB is a homologous trimer, and each subunit is bound to a zinc ion. (B) The first domain of the subunit has the triose-phosphate isomerase (TIM) barrel structure, which is composed of 8 α-helixes and 8 β-sheets. (C) The key residues (E303 and E149) related to catalytic lactose hydrolysis are located in the TIM barrel.

      Expression of the Lactase Gene bgaB

      The SDS-PAGE (Figure 7A) showed that the lactase gene was successfully overexpressed in E. coli BL21. The molecular mass of the protein was approximately 80 kDa, which was similar to the theoretical value. Moreover, electrophoresis showed that the expressed products were distributed mainly in the cell precipitate and were thus expressed in the form of inclusion bodies.
      Figure thumbnail gr7
      Figure 7SDS-PAGE analysis of lactase expression. (A) Conventionally induced expression of lactase. (B) Soluble expression of lactase with pGro7. M = marker; L1 = bacterial fragments containing empty plasmid pET-32a(+) that were induced by isopropyl β-d-1-thiogalactopyranoside (IPTG); L2 = centrifugal supernatant of L1; L3 = centrifugal precipitate of L1; L4 = bacterial fragments containing pET32-gal that were induced by IPTG; L5 = centrifugal supernatant of L4; L6 = centrifugal precipitate of L4.
      It is difficult to completely renature proteins from inclusion bodies because bioactive proteins are required for these processes, including separation, deformation, and dissolution. Therefore, to promote the soluble expression of lactase, the expression plasmid pET32-bgaB was simultaneously transformed with the molecular chaperone pGro7 into E. coli BL21 in this study. After ultrasound lysis, SDS-PAGE showed that the target protein was expressed in a soluble form, and its band (L5) was more obvious than that of the control group (Figure 7B).

      Enzymatic Properties of T242 BgaB

      The purified recombinant T242 BgaB (Figure 8A) showed the highest hydrolysis activity at 50°C, and the relative enzyme activity was above 50% in the range of 37 to 60°C, whereas the enzyme activity decreased significantly to almost inactivated levels when the temperature increased to 65°C. The loss of enzyme activity after incubation at 50°C and 55°C was lower than that at 45°C, and the residual enzyme activity was still higher than 50% after incubation at 45°C and 55°C for 100 min (Figure 8B). These findings indicate that recombinant T242 BgaB had good thermal stability at high temperatures (45–55°C) and that its optimum reaction temperature was 50°C.
      Figure thumbnail gr8
      Figure 8Effects of temperature (A, B), pH (C, D), and metal ions (E) on recombinant Bacillus coagulans T242 β-galactosidase (T242 BgaB) activity and stability. The pH for (A, B) was 6.8, the temperature for (C, D) was 50°C, and pH and temperature for (E) were 6.8 and 50°C, respectively. The different letters (a–j or A–C) indicate significant differences within or between the groups by Duncan's multiple range tests, respectively (P < 0.05). Error bars represent SD.
      The recombinant T242 BgaB showed hydrolysis activity in the pH range of 3.0 to 9.0 (Figure 8C), and the optimum activity was observed at pH 6.8 at 50°C. The recombinant T242 BgaB was incubated at the optimum reaction pH (6.8) and at other pH levels (6.2, 6.4, 6.6, and 7.0) for 1 h, and then, the enzyme activity was examined under the optimum reaction conditions (50°C, pH 6.8) to study its pH stability (Figure 8D). Recombinant T242 BgaB was highly stable within the pH range of 6.4 to 6.8 and still retained approximately 50% of its original activity. The above results indicated that recombinant T242 BgaB was an enzyme that exhibited optimum activity near neutral pH.
      Different metal ions (Cu2+, Mg2+, Ca2+, Zn2+, Mn2+, Fe2+, K+, and Na+) had different effects on the enzyme activity (50°C, pH 6.8; Figure 8E). Compared with that of the control, the enzyme activity was promoted significantly in the presence of Ca2+ and Mg2+, and it was increased by approximately 0.5 times in the presence of Ca2+. The other metal ions had no positive effect on the enzyme activity, whereas Cu2+ and Fe2+ inhibited the enzyme significantly.
      According to the recombinant T242 BgaB Lineweaver-Burk plot (Figure 9), Km = 2.21 mM and Vmax = 0.87 mM·min−1. The Km value can indicate the affinity between the enzyme and the substrate; the higher the Km value is, the weaker the affinity is. This result shows that T242 BgaB has a strong affinity with ONPG or lactose and can readily hydrolyze the substrate.
      Figure thumbnail gr9
      Figure 9Lineweaver-Burk plot of recombinant Bacillus coagulans T242 β-galactosidase (T242 BgaB). The intercept of the straight line on the longitudinal axis represents the reciprocal of the maximum reaction speed (l/Vmax), and the intercept on the transverse axis represents −l/Km. The curve equation was as follows: 1/V = 2.5484 × 1/[S] + 1.1549, R2 = 0.9912. Vmax = maximum enzymatic reaction rate; Km = Michaelis constant; V = enzymatic reaction rate; S = substrate concentration.

      DISCUSSION

      In this study, the β-galactosidase gene was amplified from the genome of Bacillus coagulans T242 by subcloning, and the amino acid sequence was deduced according to the gene sequence. It is speculated that T242 BgaB, which is a hydrophilic homologous trimer, might be a hydrolytic enzyme belonging to the GH-42 family. Each subunit's molecular mass is approximately 80 kDa, and each subunit has a TIM barrel structure, which contains highly conserved catalytic lactose hydrolysis regions. The T242 BgaB has no signal peptide or transmembrane region, so it might be an intracellular enzyme that exists in the cytoplasm. The T242 BgaB might be a novel β-galactosidase, and the genetic relationship of T242 BgaB and 3TTS was close, so T242 BgaB could be studied by referring to reports on 3TTS and other homologous lactases. For recombinant lactase expression in E. coli BL21, the expression plasmid pET32-bgaB was simultaneously transformed with the molecular chaperone pGro7 into E. coli BL21, which could promote soluble lactase expression.
      Our study showed that the properties of the recombinant lactase included good activity (the relative activity of lactase is more than 50%) at 37 to 60°C and an optimum reaction temperature of 50°C. The recombinant T242 BgaB had good stability at higher temperatures (45–55°C) and still maintain high activity. After the temperature of milk is cooled below the low-temperature, long-time (LTLT) pasteurization temperature (60–65°C;
      • Escuder-Vieco D.
      • Espinosamartos I.
      • Rodriguez J.M.
      • Corzo N.
      • Montilla A.
      • Siegfried P.
      • Pallásalonso C.R.
      • Fernández L.
      High-temperature short-time pasteurization system for donor milk in a human milk bank setting.
      ), the enzyme is added to milk to hydrolyze lactose at higher temperatures, it can hydrolyze lactose in the range of 37 to 60°C, and could be used as a supplement to other neutral mesophilic lactases. The enzyme is almost inactivated at approximately 65°C, which is very close to the temperature of low-temperature, long-time pasteurization, so the recombinant enzyme may be inactivated in the process of pasteurization, and might not hydrolyze lactose during pasteurization, resulting in T242 BgaB not completely replacing yeast lactase in the preparation of low-lactose dairy product preparations. Thus, this enzyme still needs to undergo enzyme engineering technology to further improve its performance.
      It is noteworthy that the optimum reaction temperature of the recombinant T242 BgaB was similar to that of the thermostable 3TTS (55°C;
      • Maksimainen M.
      • Paavilainen S.
      • Hakulinen N.
      • Rouvinen J.
      Structural analysis, enzymatic characterization, and catalytic mechanisms of β-galactosidase from Bacillus circulans sp. alkalophilus.
      ); both are thermostable lactases, but their optimum reaction temperatures are different from that of 1KWG, which is an extremely thermostable enzyme with an optimum reaction temperature of 75°C (
      • Ohtsu N.
      • Motoshima H.
      • Goto K.
      • Tsukasaki F.
      • Matsuzawa H.
      Thermostable β-galactosidase from an extreme thermophile, thermus sp. A4: Enzyme purification and characterization, and gene cloning and sequencing.
      ). The reason why recombinant T242 BgaB did not have extreme thermal stability was possibly due to its long-term evolution resulting in changes in amino acid residues or structures related to thermal stability, or because T242 BgaB was modified after recombinant expression (
      • Hirata H.
      • Negoro S.
      • Okada H.
      Molecular basis of isozyme formation of beta-galactosidases in Bacillus stearothermophilus: Isolation of two beta-galactosidase genes, bgaA and bgaB.
      ).
      The recombinant T242 BgaB had an optimum reaction pH of 6.8, which is similar to the natural pH of milk (approximately 6.7;
      • Pesic M.B.
      • Barac M.B.
      • Stanojevic S.P.
      • Ristic N.M.
      • Macej O.D.
      • Vrvic M.M.
      Heat induced casein–whey protein interactions at natural pH of milk: A comparison between caprine and bovine milk.
      ). Therefore, T242 BgaB is a neutral enzyme that can be developed and applied to neutral dairy products. On the contrary, it will be difficult to apply this enzyme in yogurt because of poor acid resistance; it is unstable under acidic conditions, and its relative activity is low at pH 3.0 to 5.0. However, the pasteurized milk hydrolyzed by T242 BgaB and other lactases as mentioned above can be used as raw milk for lactic acid bacteria fermentation. On this basis, lactic acid bacteria further metabolize lactose to produce low-lactose fermented milk.
      Two metal ions found at high levels in cow milk, Ca2+ and Mn2+, also promoted the hydrolytic activity of recombinant T242 BgaB in this study. The effects of Ca2+ and Mn2+ on the enzyme activity were similar to those in earlier reports (
      • Nguyen T.H.
      • Splechtna B.
      • Steinböck M.
      • Kneifel W.
      • Lettner H.P.
      • Kulbe K.D.
      • Haltrich D.
      Purification and characterization of two novel β-galactosidases from Lactobacillus reuteri.
      ;
      • Juajun O.
      • Nguyen T.H.
      • Maischberger T.
      • Iqbal S.
      • Haltrich D.
      • Yamabhai M.
      Cloning, purification, and characterization of β-galactosidase from Bacillus licheniformis DSM 13.
      ;
      • Liu Z.
      • Zhao C.
      • Deng Y.
      • Huang Y.
      • Liu B.
      Characterization of a thermostable recombinant β-galactosidase from a thermophilic anaerobic bacterial consortium YTY-70.
      ), but the mechanism is unclear. Furthermore, yeast or mold β-galactosidases are usually inhibited by Ca2+ (
      • Rosenberg Z.M.M.
      Current trends of β-galactosidase application in food technology.
      ). Hence, T242 BgaB has good prospects for use in lactose hydrolysis in cow milk. The Cu2+, Mn2+, and Fe2+ inhibited the enzyme activity significantly, which may be due to their strong oxidizability that cause the lactase to be oxidized, resulting in a decrease in lactase activity.
      • Białkowska A.M.
      • Cieśliński H.
      • Nowakowska K.M.
      • Kur J.
      • Turkiewicz M.
      A new β-galactosidase with a low temperature optimum isolated from the Antarctic Arthrobacter sp. 20B: Gene cloning, purification and characterization.
      reported that heavy metal ions decreased β-galactosidase activity and that Cu2+ was the most potent cationic inhibitor.
      At present, low-lactose or lactose-free dairy products mostly adopt a 2-stage sterilization method, the process is more complicated, and the nutrition and flavor of the product are affected by repeated sterilization. Even though T242 has good thermophilic and thermostability, it could be inactivated during the pasteurization process, so it could be used only as a supplement for other commercialized β-galactosidases during the cooling process after pasteurization, and the second stage of sterilization cannot be omitted. Moreover, T242 BgaB has a strong affinity for lactose, but its activity to hydrolyze lactose is relatively low. Hence, it is necessary to improve its stability and activity to overcome its limitations for practical application.

      ACKNOWLEDGMENTS

      This project was supported by the Educational Commission of Liaoning Province of China (J2019017), the National Natural Science Foundation (31671828; Beijing, China), and the Program of University Innovation Team in Liaoning Province (China). There are no potential conflicts of interest to disclose.

      REFERENCES

        • Aynacı E.
        • Sarı N.
        • Tümtürk H.
        Immobilization of β-galactosidase on novel polymers having Schiff bases.
        Artif. Cells Blood Substit. Immobil. Biotechnol. 2011; 39 (21323488): 259-266
        • Batra N.
        • Singh J.
        • Banerjee U.C.
        • Patnaik P.R.
        • Sobti R.C.
        Production and characterization of a thermostable beta-galactosidase from Bacillus coagulans RCS3.
        Biotechnol. Appl. Biochem. 2002; 36 (12149116): 1-6
        • Białkowska A.M.
        • Cieśliński H.
        • Nowakowska K.M.
        • Kur J.
        • Turkiewicz M.
        A new β-galactosidase with a low temperature optimum isolated from the Antarctic Arthrobacter sp. 20B: Gene cloning, purification and characterization.
        Arch. Microbiol. 2009; 191 (19771412): 825-835
        • Bilal M.
        • Iqbal H.M.
        State-of-the-art strategies and applied perspectives of enzyme biocatalysis in food sector—Current status and future trends.
        Crit. Rev. Food Sci. Nutr. 2020; 60 (31210055): 2052-2066
        • Bruno J.G.
        • Sivils J.C.
        Studies of DNA aptamer OliGreen and PicoGreen fluorescence interactions in buffer and serum.
        J. Fluoresc. 2016; 26 (27209004): 1479-1487
        • Carević M.
        • Ćorović M.
        • Mihailović M.
        • Banjanac K.
        • Milisavljević A.
        • Veličković D.
        • Bezbradica D.
        Galacto-oligosaccharide synthesis using chemically modified β-galactosidase from Aspergillus oryzae immobilised onto macroporous amino resin.
        Int. Dairy J. 2016; 54: 50-57
        • Craven G.R.
        • Steers E.
        • Anfinsen C.B.
        Purification, composition, and molecular weight of the β-D-galactosidase of Escherichia coli k12.
        J. Biol. Chem. 1965; 240 (14304855): 2468-2477
        • Dong Y.N.
        • Liu X.M.
        • Chen H.Q.
        • Xia Y.
        • Zhang H.P.
        • Zhang H.
        • Chen W.
        Enhancement of the hydrolysis activity of β-galactosidase from Geobacillus stearothermophilus by saturation mutagenesis.
        J. Dairy Sci. 2011; 94 (21338783): 1176-1184
        • Escuder-Vieco D.
        • Espinosamartos I.
        • Rodriguez J.M.
        • Corzo N.
        • Montilla A.
        • Siegfried P.
        • Pallásalonso C.R.
        • Fernández L.
        High-temperature short-time pasteurization system for donor milk in a human milk bank setting.
        Front. Microbiol. 2018; 9 (29867837): 926-942
        • Garg V.K.
        • Avashthi H.
        • Tiwari A.
        • Jain P.A.
        • Ramkete P.W.R.
        • Kayastha A.M.
        • Singh V.K.
        MFPPI-multi FASTA ProtParam interface.
        Bioinformation. 2016; 12 (28104964): 74-77
        • Gekas V.
        • Lopez-Leiva M.
        Hydrolysis of lactose: A literature review.
        Process Biochem. 1985; 20: 2-12
        • Hirata H.
        • Negoro S.
        • Okada H.
        Molecular basis of isozyme formation of beta-galactosidases in Bacillus stearothermophilus: Isolation of two beta-galactosidase genes, bgaA and bgaB.
        J. Bacteriol. 1984; 160 (6434528): 9-14
        • Juajun O.
        • Nguyen T.H.
        • Maischberger T.
        • Iqbal S.
        • Haltrich D.
        • Yamabhai M.
        Cloning, purification, and characterization of β-galactosidase from Bacillus licheniformis DSM 13.
        Appl. Microbiol. Biotechnol. 2011; 89 (20852995): 645-654
        • Ken-ichi I.
        • Sumie Y.
        • Yasushi T.
        The effects of additives on the stability of freeze-dried β-galactosidase stored at elevated temperature.
        Int. J. Pharm. 1991; 71: 137-146
        • Kim J.W.
        • Rajagopal S.N.
        Isolation and characterization of β-galactosidase from Lactobacillus crispatus.
        Folia Microbiol. (Praha). 2000; 45 (11200668): 29-34
        • Kumar S.
        • Stecher G.
        • Li M.
        • Knyaz C.
        • Tamura K.
        MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms.
        Mol. Biol. Evol. 2018; 35 (29722887): 1547-1549
        • Lin M.Y.
        • Dipalma J.A.
        • Martini M.C.
        • Gross C.J.
        • Harlander S.K.
        • Savaiano D.A.
        Comparative effects of exogenous lactase (β-galactosidase) preparations on in vivo lactose digestion.
        Dig. Dis. Sci. 1993; 38 (8223076): 2022-2027
        • Lind D.L.
        • Daniel R.M.
        • Cowan D.A.
        • Morgan H.W.
        β-Galactosidase from a strain of the anaerobic thermophile, Thermoanaerobacter.
        Enzyme Microb. Technol. 1989; 11: 180-186
        • Liò P.
        • Goldman N.
        Models of molecular evolution and phylogeny.
        Genome Res. 1998; 8 (9872979): 1233-1244
        • Liu P.
        • Xie J.
        • Liu J.
        • Ouyang J.
        A novel thermostable β-galactosidase from Bacillus coagulans with excellent hydrolysis ability for lactose in whey.
        J. Dairy Sci. 2019; 102 (31477300): 9740-9748
        • Liu Z.
        • Zhao C.
        • Deng Y.
        • Huang Y.
        • Liu B.
        Characterization of a thermostable recombinant β-galactosidase from a thermophilic anaerobic bacterial consortium YTY-70.
        Biotechnol. Biotecnol. Equip. 2015; 29: 547-554
        • Maksimainen M.
        • Paavilainen S.
        • Hakulinen N.
        • Rouvinen J.
        Structural analysis, enzymatic characterization, and catalytic mechanisms of β-galactosidase from Bacillus circulans sp. alkalophilus.
        FEBS J. 2012; 279 (22385475): 1788-1798
        • Mangiagalli M.
        • Lapi M.
        • Maione S.
        • Orlando M.
        • Brocca S.
        • Pesce A.
        • Barbiroli A.
        • Camilloni C.
        • Pucciarelli S.
        • Lotti M.
        • Nardini M.
        The co-existence of cold activity and thermal stability in an Antarctic GH42 β-galactosidase relies on its hexameric quaternary arrangement.
        FEBS J. 2020; (32363751)febs.15354
        • National Standard of the People's Republic of China
        GB/T 33409–2016. Determination of the activity of beta-galactosidase-Spectrophotometric method.
        General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China and Standardization Administration, Beijing, China2016
        • Nguyen T.H.
        • Splechtna B.
        • Steinböck M.
        • Kneifel W.
        • Lettner H.P.
        • Kulbe K.D.
        • Haltrich D.
        Purification and characterization of two novel β-galactosidases from Lactobacillus reuteri.
        J. Agric. Food Chem. 2006; 54 (16819907): 4989-4998
        • O'Connell S.
        • Walsh G.
        Purification and properties of a β-galactosidase with potential application as a digestive supplement.
        Appl. Biochem. Biotechnol. 2007; 141 (17625262): 1-14
        • Ohtsu N.
        • Motoshima H.
        • Goto K.
        • Tsukasaki F.
        • Matsuzawa H.
        Thermostable β-galactosidase from an extreme thermophile, thermus sp. A4: Enzyme purification and characterization, and gene cloning and sequencing.
        Biosci. Biotechnol. Biochem. 1998; 62 (9757561): 1539-1545
        • Pesic M.B.
        • Barac M.B.
        • Stanojevic S.P.
        • Ristic N.M.
        • Macej O.D.
        • Vrvic M.M.
        Heat induced casein–whey protein interactions at natural pH of milk: A comparison between caprine and bovine milk.
        Small Rumin. Res. 2012; 108: 77-86
        • Peterson G.L.
        Review of the Folin phenol protein quantitation method of Lowry, Rosebrough, Farr and Randall.
        Anal. Biochem. 1979; 100 (393128): 201-220
        • Rico-Díaz A.
        • Álvarez-Cao M.E.
        • Escuder-Rodríguez J.J.
        • González-Siso M.I.
        • Cerdán M.E.
        • Becerra M.
        Rational mutagenesis by engineering disulphide bonds improves Kluyveromyces lactis beta-galactosidase for high-temperature industrial applications open.
        Sci. Rep. 2017; 745535
        • Rosenberg Z.M.M.
        Current trends of β-galactosidase application in food technology.
        J. Food Nutr. Res. 2006; 45: 47-54
        • Samiee M.
        • Kohnehrouz B.B.
        • Norouzi M.
        Cloning and bioinformatics analysis of accD gene from bell pepper (Capsicum annuum).
        Int. J. Agric. Biosci. 2016; 5: 67-72
        • Santibáñez L.
        • Fernández-Arrojo L.
        • Guerrero C.
        • Plou F.J.
        • Illanes A.
        Removal of lactose in crude galacto-oligosaccharides by β-galactosidase from Kluyveromyces lactis.
        J. Mol. Catal. B Enzym. 2016; 133: 85-91
        • Santos A.
        • Ladero M.
        • Garcıa-Ochoa F.
        Kinetic modeling of lactose hydrolysis by a β-galactosidase from Kluyveromices fragilis.
        Enzyme Microb. Technol. 1998; 22: 558-567
        • Seddigh S.
        Comprehensive comparison of two protein family of P-ATPases (13A1 and 13A3) in insects.
        Comput. Biol. Chem. 2017; 68 (28475980): 266-281
        • Shen L.M.
        • Gu Q.M.
        • Li Y.T.
        • Fang S.
        • Gao S.
        Basic Biochemistry.
        China Forestry Publishing House, Beijing, China1996
        • Solomon H.V.
        • Tabachnikov O.
        • Feinberg H.
        • Govada L.
        • Chayen N.E.
        • Shoham Y.
        • Shoham G.
        Crystallization and preliminary crystallographic analysis of GanB, a GH42 intracellular β-galactosidase from Geobacillus stearothermophilus.
        Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2013; 69 (24100561): 1114-1119
        • Solomon H.V.
        • Tabachnikov O.
        • Lansky S.
        • Salama R.
        • Feinberg H.
        • Shoham Y.
        • Shoham G.
        Structure–function relationships in Gan42B, an intracellular GH42 b-galactosidase from Geobacillus stearothermophilus.
        Acta Crystallogr. D Biol. Crystallogr. 2015; 71 (26627651): 2433-2448
        • Teplitsky A.
        • Feinberg H.
        • Gilboa R.
        • Lapidot A.
        • Mechaly A.
        • Stojanoff V.
        • Capel M.
        • Shoham Y.
        • Shoham G.
        Crystallization and preliminary X-ray analysis of the thermostable alkaline-tolerant xylanase from Bacillus stearothermophilus T-6.
        Acta Crystallogr. D Biol. Crystallogr. 1997; 53 (15299894): 608-611
        • Ugidos-Rodríguez S.
        • Matallana-González M.C.
        • Sánchez-Mata M.C.
        Lactose malabsorption and intolerance: A review.
        Food Funct. 2018; 9 (29999504): 4056-4068
        • Viborg A.H.
        • Fredslund F.
        • Katayama T.
        • Nielsen S.K.
        • Svensson B.
        • Kitaoka M.
        • Lo Leggio L.
        • Hachem M.A.
        A β1–6/β1–3 galactosidase from Bifidobacterium animalis ssp. lactis Bl-04 gives insight into sub-specificities of β-galactoside catabolism within Bifidobacterium.
        Mol. Microbiol. 2014; 94: 1024-1040
        • Wanarska M.
        • Kur J.
        • Pladzyk R.
        • Turkiewicz M.
        Thermostable Pyrococcus woesei β-D-galactosidase–High level expression, purification and biochemical properties.
        Acta Biochim. Pol. 2005; 52 (16273127): 781-788
        • Wen F.
        • Celoy R.
        • Price I.
        • Ebolo J.J.
        • Hawes M.C.
        Identification and characterization of a rhizosphere β-galactosidase from Pisum sativum L.
        Plant Soil. 2008; 304: 133-144
        • Whitlock G.C.
        • Robida M.D.
        • Judy B.M.
        • Omar Q.
        • Brown K.A.
        • Arpaporn D.
        • Katherine T.
        • Shane M.
        • Andrey L.
        • Borovkov A.Y.
        Protective antigens against glanders identified by expression library immunization.
        Front. Microbiol. 2011; 2 (22125550): 227
        • Yiğit N.O.
        • Koca S.B.
        • Didinen B.I.
        • Diler I.
        Effect of β-mannanase and α-Galactosidase supplementation to soybean meal based diets on growth, feed efficiency and nutrient digestibility of rainbow trout, Oncorhynchus mykiss (Walbaum).
        Asian-Australas. J. Anim. Sci. 2014; 27 (25050005): 700-705