Advertisement

Effects of hydrogen peroxide and l-tryptophan on antioxidative potential, apoptosis, and mammalian target of rapamycin signaling in bovine intestinal epithelial cells

  • Author Footnotes
    * These authors contributed equally to this work.
    Xiaoshi Wei
    Footnotes
    * These authors contributed equally to this work.
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Author Footnotes
    * These authors contributed equally to this work.
    Dongping Li
    Footnotes
    * These authors contributed equally to this work.
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Changdong Feng
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Huiling Mao
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Jinpeng Zhu
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Yanjun Cui
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Jinyong Yang
    Affiliations
    Zhejiang Province Animal Husbandry Technology Promotion and Breeding Livestock and Poultry Monitoring Station, Hangzhou, Zhejiang 310021, P. R. China
    Search for articles by this author
  • Hui Gao
    Affiliations
    Zhejiang Province Animal Husbandry Technology Promotion and Breeding Livestock and Poultry Monitoring Station, Hangzhou, Zhejiang 310021, P. R. China
    Search for articles by this author
  • Chong Wang
    Correspondence
    Corresponding author
    Affiliations
    College of Animal Science and Technology and College of Veterinary Medicine, Zhejiang Agriculture and Forestry University, Hangzhou, Zhejiang 311300, P. R. China
    Search for articles by this author
  • Author Footnotes
    * These authors contributed equally to this work.
Open AccessPublished:October 11, 2022DOI:https://doi.org/10.3168/jds.2022-21869

      ABSTRACT

      Amino acids are primarily absorbed in the ruminant small intestine, and the small intestine is a target organ prone to oxidative stress, causing intestinal disfunction. Previous study suggested that l-Trp could benefit intestinal function and production performance. This study aimed to explore the effects of l-Trp on hydrogen peroxide (H2O2)-induced oxidative injury in bovine intestinal epithelial cells (BIEC) and the potential mechanism. The effects of l-Trp on cell apoptosis, antioxidative capacity, AA transporters, and the mammalian target of rapamycin (mTOR) signaling pathway were evaluated in BIEC treated with 0.8 mM l-Trp for 2 hours combined with or without H2O2 induction. In addition, to explore whether the effects of 0.8 mM l-Trp on oxidative stress were related to mTOR, an mTOR-specific inhibitor was used. The percentage of apoptosis was measured using flow cytometry. The relative gene abundance and protein expression in BIEC were determined using real-time PCR and Western blot assay, respectively. Results showed l-Trp at 0.4 and 0.8 mM enhanced the cell viability, and it was inhibited by l-Trp at 6.4 mM. l-Tryptophan at 0.4, 0.8, and 1.6 mM remarkably decreased the percentage of apoptosis and enhanced antioxidative capacity in H2O2-mediated BIEC. Moreover, l-Trp at 0.8 mM increased the relative gene abundance and protein expression of antioxidative enzymes and AA transporters, and the mTOR signaling pathway. The mTOR inhibitor lowered the protein expression of large neutral amino acid transporter 1, but the inhibition of mTOR did not alter the activities of catalase and superoxide dismutase or protein expression of alanine-serine-cysteine transporter 2 with or without H2O2 induction. l-Tryptophan increased catalase and superoxide dismutase activities in H2O2-mediated BIEC, although not with a present mTOR inhibitor. l-Tryptophan increased the protein expression of large neutral amino acid transporter 1 and alanine-serine-cysteine transporter 2 in H2O2-mediated BIEC with or without the presence of an mTOR inhibitor. The present work suggested that l-Trp supplementation could alleviate oxidative injury in BIEC by promoting antioxidative capacity and inhibiting apoptosis, and the mTOR signal played vital roles in the alleviation.

      Key words

      INTRODUCTION

      The small intestine is not only the main site for digestion and absorption of rumen undegradable starch and protein for ruminants, but also a defensive barrier (
      • Suzuki T.
      Regulation of the intestinal barrier by nutrients: The role of tight junctions.
      ). However, it is susceptible to damage caused by reactive oxygen species (ROS), inducing apoptosis and reducing antioxidant capacity, and further intestinal disorders (
      • Sottero B.
      • Rossin D.
      • Poli G.
      • Biasi F.
      Lipid oxidation products in the pathogenesis of inflammation-related gut diseases.
      ;
      • Lan R.
      • Chang Q.
      • Wei L.
      • Zhao Z.
      The protect effects of chitosan oligosaccharides on intestinal integrity by regulating oxidative status and inflammation under oxidative stress.
      ). Weaning is a potent stressor for dairy calves because of the extreme dietary shift, which likely leads to intestinal barrier dysfunction and damage (
      • Wood K.M.
      • Palmer S.I.
      • Steele M.A.
      • Metcalf J.A.
      • Penner G.B.
      The influence of age and weaning on permeability of the gastrointestinal tract in Holstein bull calves.
      ;
      • Li C.
      • Wang W.
      • Liu T.
      • Zhang Q.
      • Wang G.
      • Li F.
      • Li F.
      • Yue X.
      • Li T.
      Effect of early weaning on the intestinal microbiota and expression of genes related to barrier function in lambs.
      ), further increasing morbidity and mortality. Elevated blood ROS production was found in weaning dairy calves (
      • Bordignon R.
      • Volpato A.
      • Glombowsky P.
      • Souza C.F.
      • Baldissera M.D.
      • Secco R.
      • Pereira W.A.B.
      • Leal M.L.R.
      • Vedovatto M.
      • Da Silva A.S.
      Nutraceutical effect of vitamins and minerals on performance and immune and antioxidant systems in dairy calves during the nutritional transition period in summer.
      ), and when the balance between defensive potential (ability) (enzymatic system and non-enzymatic antioxidants) and ROS production is upset, oxidative stress occurs (
      • Lykkesfeldt J.
      • Svendsen O.
      Oxidants and antioxidants in disease: Oxidative stress in farm animals.
      ). Hence, protecting small intestine from oxidative stress induced by weaning is crucial to maintaining intestinal function. Identifying an ideal nutritional candidate, which has antioxidant capacity, is urgently needed.
      Tryptophan, an essential aromatic α-amino acid, is a substrate for protein synthesis and a precursor of molecules crucial for whole-body homeostasis (
      • Bender D.A.
      Biochemistry of tryptophan in health and disease.
      ;
      • Oxenkrug G.F.
      Genetic and hormonal regulation of tryptophan-kynurenine metabolism: implications for vascular cognitive impairment, major depressive disorder, and aging.
      ).
      • Yeste N.
      • Bassols A.
      • Vidal M.
      • Bach A.
      • Terré M.
      Evaluating the potential role of tryptophan in calf milk replacers to facilitate weaning.
      reported that supplementing 4.5 g/d of Trp via milk replacer might suggest some benefits in Trp uptake or implications in oxidative defenses in calves during weaning. Relatively little is known about the effects of l-Trp on oxidative stress and intestinal function in ruminants, although studies did suggest that l-Trp had remarkable benefits on intestinal barrier function in nonruminants (
      • Shen Y.B.
      • Voilque G.
      • Odle J.
      • Kim S.W.
      Dietary L-tryptophan supple- mentation with reduced large neutral amino acids enhances feed efficiency and decreases stress hormone secretion in nursery pigs under social-mixing stress.
      ,
      • Shen Y.B.
      • Voilque G.
      • Kim J.D.
      • Odle J.
      • Kim S.W.
      Effects of increasing tryptophan intake on growth and physiological changes in nursery pigs.
      ;
      • Wang H.
      • Ji Y.
      • Wu G.
      • Sun K.
      • Sun Y.
      • Li W.
      • Wang B.
      • He B.
      • Zhang Q.
      • Dai Z.
      • Wu Z.
      L-tryptophan activates mammalian target of rapamycin and enhances expression of tight junction proteins in intestinal porcine epithelial cells.
      ). Whether supplying l-Trp could help with scavenging ROS and protect the small intestine from oxidative injury in ruminants is unknown, as is the underlying mechanism.
      Based on these considerations, we hypothesized that l-Trp could alleviate oxidative injury and maintain intestinal function. Because enterocytes are key components of the intestinal mucosa epithelium and major targets of ROS, bovine intestinal epithelial cells (BIEC) were used to explore the effect on intestinal function of oxidative stress in vitro. In addition, hydrogen peroxide (H2O2) is an abundant and stable ROS and widely used to induce oxidative injury (
      • Zhang H.
      • Liu X.
      • Fan Y.
      • Yu Y.
      • Loor J.J.
      • Elsabagh M.
      • Peng A.
      • Wang H.
      L-Arginine alleviates hydrogen peroxide-induced oxidative damage in ovine intestinal epithelial cells by regulating apoptosis, mitochondrial function, and autophagy.
      ;
      • Mao H.
      • Zhang Y.
      • Ji W.
      • Yun Y.
      • Wei X.
      • Cui Y.
      • Wang C.
      Leucine protects bovine intestinal epithelial cells from hydrogen peroxide-induced apoptosis by alleviating oxidative damage.
      ). Therefore, to test the hypothesis, we investigated the effects of l-Trp on antioxidative capacity, cell apoptosis and expression of AA transporters in BIEC mediated by H2O2. We also explored the underlying mechanism by which l-Trp alleviated oxidative stress.

      MATERIALS AND METHODS

      Cell Culture

      The primary BIEC were isolated and cultured completely as described previously (
      • Zhan K.
      • Lin M.
      • Liu M.M.
      • Sui Y.N.
      • Zhao G.Q.
      Establishment of primary bovine intestinal epithelial cell culture and clone method.
      ). The primary BIEC were then immortalized, and BIEC, a cell line, were used in this study (
      • Zhan K.
      • Yang T.Y.
      • Chen Y.
      • Jiang M.C.
      • Zhao G.Q.
      Propionate enhances the expression of key genes involved in the gluconeogenic pathway in bovine intestinal epithelial cells.
      ). The cells were seeded and cultured in DMEM/F12 complete medium (11330057, Gibco) supplemented with 10% fetal bovine serum (10099141, Gibco), 100 U/mL penicillin and 100 μg/mL streptomycin (10378016, Gibco), 4 mM glutamine (G8540, Sigma-Aldrich), 15 ng/mL epidermal growth factor (E4127, Sigma-Aldrich), 1 μg/mL hydrocortisone (H0888, Sigma-Aldrich), and 1% NEAA [containing glycine, l-alanine, l-asparagine, l-aspartic acid, l-glutamic acid, l-proline, and l-serine, 10 mM each (TMS-001, Sigma-Aldrich)] and seeded on 10-cm2 plastic dishes (351092, Corning). Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2, and the medium was exchanged every 24 h. When the confluence was between 85% and 95%, cells were passaged routinely. The BIEC purified in 20–25 passages were used for experimental assays. In this study, every experiment was repeated three times, and within each date, three wells were performed in each treatment.

      Establishing an Oxidative Stress Model of BIEC Induced by H2O2

      The damage caused by H2O2 is considered a simple and reproducible model for inducing oxidative stress. The BIEC were treated with H2O2 (applied at the Pharmaceutical Distribution Center of Zhejiang Agricultural and Forestry University) at concentrations of 0, 0.5, 1.0, 1.5, and 2.0 mM for 2 and 4 h, respectively. The H2O2 dose was selected according to previous studies on bovine intestinal and mammary epithelial cells (
      • Sun X.
      • Chang R.
      • Tang Y.
      • Luo S.
      • Jiang C.
      • Jia H.
      • Xu Q.
      • Dong Z.
      • Liang Y.
      • Loor J.J.
      • Xu C.
      Transcription factor EB (TFEB)-mediated autophagy protects bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.
      ;
      • Mao H.
      • Zhang Y.
      • Ji W.
      • Yun Y.
      • Wei X.
      • Cui Y.
      • Wang C.
      Leucine protects bovine intestinal epithelial cells from hydrogen peroxide-induced apoptosis by alleviating oxidative damage.
      ) and our pilot study.

      Cell Viability

      The effect of H2O2 on cell viability was determined using cell counting kit-8 (CCK-8) assay (C0042, Beyotime Biotechnology) in accordance with the manufacturer's protocol. In brief, BIEC were plated within 96-well culture plates (Corning) at the density of 104 cells/well and cultured for 24 h before treatment. After culturing for 2 and 4 h, respectively, the CCK-8 solution was added and incubated at 37°C for another 2 h. The absorbance was tested with a microplate reader at 450 nm. All values were expressed as a proportion of the control.

      Determination of Lactate Dehydrogenase

      After stimulating by H2O2 at different concentrations for 2 and 4 h, the lactate dehydrogenase (LDH), an important indicator of cell membrane integrity, was determined using a commercial LDH assay kit (A020–2-2, Jiancheng Bioengineering Institute). The cell supernatant was gathered and added with solutions sequentially, and then incubated according to the instructions. After standing at room temperature for 5 min, the samples were tested at 450 nm using a microplate reader.

      Antioxidative Status

      After incubation, the BIEC were rinsed with ice-cold PBS and lysed with RIPA Lysis Buffer R2220. Cells were centrifuged at 1,500 × g and 4°C for 15 min to remove cellular debris, and the cell supernatant was collected. Bicinchoninic acid protein assay reagent was used to determine cellular protein concentration (A045–4-2, Jiancheng Bioengineering Institute). The samples were added with solutions, incubated at 37°C for 30 min and tested at 450 nm. In addition, the intracellular total antioxidant capacity (T-AOC), the activities of superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) were determined as detailed in our previous study (
      • Wei X.S.
      • Zhao H.H.
      • He J.J.
      • Yin Q.Y.
      • Cao Y.C.
      • Cai C.J.
      • Yao J.H.
      Maternal nicotinamide supplementation during the perinatal period modifies the small intestine morphology and antioxidative status of offspring kids.
      ). All data presented were normalized to protein concentration.

      Flow Cytometry

      To measure the percentage of apoptosis of BIEC, the flow cytometry (FACS Calibur, Becton, Dickinson and Company) and Annexin V-FITC apoptosis assay kits (K101–100, Univ Biotech Company) were used. The BIEC were washed with cold PBS then fixed in binding buffer mixed with 5 μL of FITC Annexin V and 5 μL of PI. After being incubated in the dark at room temperature for 15 min, the cells were added with 400 μL of binding buffer then analyzed within 30 min. The cells located at right 2 quadrants of all plots were defined as the apoptotic cells, and the percentage of apoptotic cells were analyzed using the FlowJo-V10 software (BD).

      Effect of l-Trp on BIEC Challenged by H2O2

      The l-Trp (purity ≥98.5%, A601911, Sango Biotech) was dissolved with medium. Doses and treatment time were selected based on following considerations: First, previous studies have shown that serum Trp concentration in dairy calves ranged from 0.04 to 0.09 mM (
      • Yeste N.
      • Bassols A.
      • Vidal M.
      • Bach A.
      • Terré M.
      Evaluating the potential role of tryptophan in calf milk replacers to facilitate weaning.
      ;
      • Petzel E.A.
      • Acharya S.
      • Bailey E.A.
      • Brake D.W.
      Effects of polymerization of casein and sources of lysine on amino acid bioavailability among calves fed liquid-based diets.
      ). Due to the lack of experiment with Trp supplementation in calves, it is unknown how much serum Trp concentration in calves could be increased by Trp supplementation. Second, in our pilot study (details shown in supplementary experiment), l-Trp concentrations lower than 6.4 mM did not affect cell viability after 2 h of incubation (Supplemental Figure S1, https://doi.org/10.6084/m9.figshare.21202088.v1). In addition, after 12 h of incubation, l-Trp at 0.05, 0.1, and 0.2 mM did not alter cell viability or LDH, and l-Trp at 0.4 and 0.8 mM increased cell viability with no effect on LDH (Supplemental Figures S2A and S2B, https://doi.org/10.6084/m9.figshare.21202088.v1). Thus, the conditions of l-Trp at 0.4, 0.8, 1.6, and 3.2 mM for 2 h of incubation were chosen for use in the next experiment.
      This experiment aimed to explore the effect of l-Trp on oxidative stress in BIEC and its potential mechanism. The BIEC were incubated with 1 mM H2O2 and several concentrations of l-Trp for 2 h. The treatments were H2O2, H2O2 + 0.4 mM l-Trp, H2O2 + 0.8 mM l-Trp, H2O2 + 1.6 mM l-Trp, H2O2 + 3.2 mM l-Trp. The cell viability, percentage of apoptosis, LDH concentration of cell supernatant, and intracellular T-AOC were measured as described previously.
      Based on the results, l-Trp at 0.8 mM was used for the next experiment. The treatments were CON, H2O2, l-Trp, and H2O2 + l-Trp. The relative mRNA expression and protein expression of antioxidant enzymes [CAT, manganese superoxide dismutase (SOD2), glutathione peroxidase 1 (GPX1)], transporters of AA [large neutral amino acid transporter 1 (LAT1), and alanine-serine-cysteine transporter2 (ASCT2)], and mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase 1 (S6K1)/eukaryotic initiation factor 4E-binding protein (4EBP1) were measured.

      Inhibition of mTOR in BIEC

      To explore the association between mTOR and oxidative stress in BIEC with or without l-Trp supply, mTOR inhibition assays were carried out. The specific mTOR inhibitor rapamycin (Rapa, Selleck Chemicals) was dissolved in dimethylsulfoxide (Sigma-Aldrich) to produce a 10 mM stock solutions and stored at −80°C. Before applications in cell treatments, stock solutions were diluted to working concentrations. The treatments were control, Rapa, H2O2, H2O2 + Rapa, H2O2 + l-Trp, and H2O2 + Rapa + l-Trp. After 2 h treatments, the total RNA and proteins were separately collected for further analyses. Based on the study described previously, the dose of l-Trp used was 0.8 mM, and the Rapa used was 10 nM, which was selected based on a previous study (
      • Guo L.
      • Liang Z.
      • Zheng C.
      • Liu B.
      • Yin Q.
      • Cao Y.
      • Yao J.
      Leucine affects α-amylase synthesis through PI3K/Akt-mTOR signaling pathways in pancreatic acinar cells of dairy calves.
      ) and a previous dose response experiment in our laboratory.

      RNA Extraction and Real-Time PCR Analysis

      Total RNA was extracted from BIEC using FavorPrep Blood/Cultured Cell Total RNA Mini Kit (Favorgen). The concentration and purity of RNA samples were determined by measuring the absorbance at 260 and 280 nm using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific Inc.). RNA samples with an optical density ratio at 260/280 nm >1.8 were then reverse transcribed for cDNA synthesis using a Prime Script RT Reagent Kit (Takara). The quantitative PCR was performed by SYBR Premix Ex Taq II Kit (Takara) in the CFX96 (Bio-Rad). Table 1 shows primer sequences. The 20-μL reaction system (containing 6.4 μL of nuclease-free water, 0.8 μL of forward primer, 0.8 μL of reverse primer, 2 μL of cDNA, and 10 μL of SYBR Premix Ex Taq) were amplified at 95°C for 60 s, followed by 40 cycles at 95°C for 30 s and 58°C for 60 s. The PCR reaction efficiencies were between 90 and 100%. The relative stability of two candidate genes (GAPDH and β-actin) was calculated by GeNorm software. We found that β-actin was expressed in comparable abundance and not affected by experimental factors (
      • Vandesompele J.
      • De Preter K.
      • Pattyn F.
      • Poppe B.
      • Van Roy N.
      • De Paepe A.
      • Speleman F.
      Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.
      ); thus, the β-actin was chosen as an internal normalization control. The relative mRNA abundances of genes were calculated using the 2−ΔΔCt method and normalized to β-actin. Three replicates were performed in each sample.
      Table 1The primers sequences used in this study (F = forward; R = reverse)
      Gene
      β-actin, actin gamma 1 (ACTG1); catalase (CAT); glutathione peroxidase (GPX1); superoxide dismutase 2 (SOD2); large neutral amino acid transporter 1 (LAT1); alanine-serine-cysteine transporter 2 (ASCT2); mammalian target of rapamycin (MTOR); eukaryotic initiation factor 4E-binding protein (4EBP1); ribosomal protein S6 kinase 1 (S6K1).
      Accession no.Primer sequence (5′–3′)Product length (bp)Efficiency (%)R2
      ACTG1NM_173979.3F: CGGGAAATCGTCCGTGAC R: CCGTGTTGGCGTAGAGGT277960.996
      CATNM_001035386.1F: AGATACTCCAAGGCGAAGGTG R: AAAGCCACGAGGGTCACGAAC120980.992
      GPX1NM_174076.3F: GAGCCCTTCAACCTGTCCTC R: GCGTTTTCCTGATGCCCAAAC179930.999
      SOD2NM_201527.2F: CGTGACTTTGGTTCCTTTGCC R: GCGTCCCTGCTCCTTATTGA1081000.998
      LAT1NM_174613.2F: TCATCCAGATCGGGAAGGGT R: TGACGCCCAAGTGGTAGTTC321920.991
      ASCT2NM_174601.2F: GTGCTCACTCTGGCCATCAT R: AGTTGCAGTTCTCTGTGCGA175910.989
      MTORNM_001081514.1F: CCATCCAGAGCCCACAGAA R: GGGACTATGCGAGTAGAAGAG107930.990
      4EBP1NM_001077893.2F: AGGATCATCTATGACCGGAAGT R: CGCCTGTAGGGCTAGTGAC109920.993
      S6K1NM_205816.1F: ATGCTGCTTCTCGTCTTG R: CTGGTTGGCACTTTCACT227950.992
      1 β-actin, actin gamma 1 (ACTG1); catalase (CAT); glutathione peroxidase (GPX1); superoxide dismutase 2 (SOD2); large neutral amino acid transporter 1 (LAT1); alanine-serine-cysteine transporter 2 (ASCT2); mammalian target of rapamycin (MTOR); eukaryotic initiation factor 4E-binding protein (4EBP1); ribosomal protein S6 kinase 1 (S6K1).

      Protein Preparation and Western Blot

      At the end of the incubation period, the BIEC were collected and lysed in ice-cold RIPA Lysis Buffer (P0013C, Beyotime Biotechnology). The protein concentration was determined by BCA protein assay kit (P0012S, Beyotime Biotechnology). Samples (10 μg/lane) were loaded and separated by 10% SDS polyacrylamide gels and transferred to polyvinylidene difluoride membranes (IPVH00010, Millipore). The membranes were blocked in 5% BSA for 1 h at room temperature and then incubated with primary antibodies at 4°C, including SOD2 (1:1,000, catalog number ab68155, CST), CAT, GPX1, LAT1, ASCT2, P-mTOR, mTOR, P-S6K1, S6K1, P-4EBP1, 4EBP1 (1:3,000, catalog number A11780; 1:1,000, catalog number A1110; 1:1,000, catalog number A2833; 1:3,000, catalog number A6981; 1:2,000, catalog number AP0094; 1:1,000, catalog number A2445; 1:2,000, catalog number AP0564; 1:1,000, catalog number A16968; 1:2,000, catalog number AP0031; 1:1,000, catalog number A1248; respectively, ABclonal) and β-actin (1:1,000, Hua'an Biotechnology). Then, membranes were incubated with the goat anti-rabbit immunoglobulin G horseradish peroxidase-conjugated secondary antibody (1:3000, catalog number D110058; Sangon Biotech) for 1 h at room temperature. The blots were visualized with enhanced chemiluminescence (Beyotime Biotechnology) immunoblotting detection system. The relative quantity of protein bands was determined by Image J (National Institutes of Health) and normalized to β-actin protein in each sample. Three replicates were performed in each sample.

      Statistical Analysis

      The distribution of normality and homogeneity of variances was evaluated before the analysis. Next, the data were analyzed by one-way ANOVA, and Duncan's multiple comparison tests were used to compare group differences if a significant treatment effect was observed using SPSS 20.0 (SPSS Inc.). Data were expressed as mean ± the standard error of the mean. The significance level was P ≤ 0.05.

      RESULTS

      Effect of H2O2 on Oxidative Injury of BIEC

      Figure 1A shows the effects of H2O2 on cell viability, LDH concentration of supernatant and intracellular T-AOC. Cell viability was decreased in 1, 1.5, and 2 mM H2O2 treatment groups for 2 and 4 h incubation compared with the control group (P < 0.05), and the cell viability in 0.5 mM H2O2 treatment did not change either for 2 or 4 h. The LDH concentration increased in all treatment groups (0.5, 1, 1.5, and 2 mM H2O2) for both 2 and 4 h incubation compared with the control group (P < 0.05). Intracellular T-AOC decreased in 1, 1.5, and 2 mM H2O2 treatment groups for 2 h, and decreased in 0.5, 1, 1.5, and 2 mM H2O2 treatment groups for 4 h (P < 0.05). Figure 1B shows the results of enzyme activities of SOD, GPX, and CAT for 2 h incubation. The enzyme activities of SOD and GPX of BIEC decreased in 1, 1.5, and 2 mM H2O2 treatment groups compared with the control group (P < 0.05). The CAT activity decreased with the increase of H2O2 (P < 0.05). Figure 1C shows representative charts of flow cytometry analyses of apoptosis and the analyses results. At 0.5, 1, 1.5, and 2 mM, H2O2 increased the percentage of apoptosis of BIEC (P < 0.05). Based on these results, H2O2 at 1 mM for 2 h incubation was chosen as the condition to trigger the oxidative status in next experiments.
      Figure thumbnail gr1
      Figure 1Hydrogen peroxide (H2O2)-induced oxidative injury in bovine intestinal epithelial cells (BIEC). (A) The cell viability, lactate dehydrogenase (LDH) concentration of supernatant, and intracellular total antioxidant capacity (T-AOC) of BIEC. Cells were treated with different concentrations of H2O2 (0, 0.5, 1, 1.5, and 2 mM) for 2 and 4 h, respectively. The results of cell viability are shown as the proportion of control. The result of T-AOC was normalized to protein expression. gprot = grams of protein; mgprot = milligrams of protein. (B) The activities of superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) of BIEC. Cells were treated with different concentrations of H2O2 (0, 0.5, 1, 1.5, and 2 mM) for 2 h. The intracellular T-AOC, the activities of SOD, GPX, and CAT were normalized to protein concentration. (C) The percentage of apoptosis of BIEC. Cells were treated with different concentrations of H2O2 (0, 0.5, 1, 1.5, and 2 mM) for 2 h and determined by annexin V-fluorescein isothiocyanate/propidium iodide staining and flow cytometry. The cells located in the right 2 quadrants (Q2 and Q3) of all plots were defined as the apoptotic cells, and the percentage of apoptotic cells was analyzed using the FlowJo-V10 software (BD). The data are shown as the mean ± SEM. The values with different lowercase letters are significantly different (P ≤ 0.05).

      L-Tryptophan Regulated the Oxidative Stress of BIEC Mediated by H2O2

      Cell Viability, LDH Concentration, T-AOC, and Percentage of Apoptosis

      Figure 2A shows the effect of l-Trp on cell viability, LDH concentration of supernatant, and intercellular T-AOC, and Figure 2B shows the percentage of apoptosis. Cell viability increased in all l-Trp groups, and the 0.8 mM l-Trp treatment group had the highest cell viability (P < 0.05). Compared with control group, the LDH concentration decreased in all l-Trp treatment groups, and the LDH in 0.4, 0.8, and 1.6 mM l-Trp groups was lower than that in 3.2 mM l-Trp group (P < 0.05). The T-AOC of BIEC was elevated in 0.4, 0.8, and 1.6 mM l-Trp groups (P < 0.05) as compared with control group, and the T-AOC in 3.2 mM l-Trp group was unaffected. Compared with control group, the percentage of apoptosis decreased in all l-Trp groups, and the rate in 0.8, 1.6, and 3.2 mM l-Trp groups was lower than that in 0.4 mM l-Trp group (P < 0.05). Based on these results and considering the effectiveness and efficiency of l-Trp, l-Trp at 0.8 mM was chosen for use in the next experiment.
      Figure thumbnail gr2
      Figure 2Effects of l-Trp on oxidative stress of bovine intestinal epithelial cells (BIEC) mediated by hydrogen peroxide (H2O2). Cells were treated with different concentrations of l-Trp (0, 0.4, 0.8, 1.6, and 3.2 mM) and H2O2 (1 mM) for 2 h. (A) The cell viability, lactate dehydrogenase (LDH) concentration of supernatant, and intracellular total antioxidant capacity (T-AOC). The results of cell viability are presented as the proportion of control. The intracellular T-AOC was normalized to protein concentration. gprot = grams of protein. (B) The percentage of apoptosis of BIEC was determined by annexin V-fluorescein isothiocyanate or propidium iodide staining and flow cytometry. The cells located in the right 2 quadrants (Q2 and Q3) of all plots were defined as the apoptotic cells, and the percentage of apoptotic cells was analyzed using the FlowJo-V10 software (BD). The data are shown as mean ± SEM. The values with different lowercase letters are significantly different (P ≤ 0.05).

      Antioxidant Enzymes

      Figures 3A, 3B, and 3C show relative mRNA abundance and protein expression of CAT, SOD2, and GPX1, respectively. The relative mRNA abundance and protein expression of CAT and SOD2 decreased in H2O2 group, and increased in the l-Trp group as compared with control (P < 0.05). The relative mRNA abundance of GPX1 in the l-Trp group was higher than in the control (P < 0.05), and the protein expression was unchanged. Moreover, the relative mRNA abundance and protein expression of CAT, GPX1, and SOD2 in the H2O2 + l-Trp group was higher than in the H2O2 group (P < 0.05).
      Figure thumbnail gr3
      Figure 3l-Tryptophan affected the expression of antioxidant enzymes and amino acid transporters in bovine intestinal epithelial cells (BIEC) mediated by hydrogen peroxide (H2O2). Cells were treated with l-Trp (0 and 0.8 mM) combined with or without H2O2 (1 mM) for 2 h. The relative mRNA abundance and protein expression of antioxidant enzymes and amino acid transporters were measured using real-time PCR and Western blot, respectively. (A, B, and C) The relative mRNA abundance and protein expression of catalase (CAT), manganese superoxide dismutase (SOD2), and glutathione peroxidase 1 (GPX1). (D and E) The relative mRNA abundance and protein expression of large neutral amino acid transporter 1 (LAT1) and alanine-serine-cysteine transporter 2 (ASCT2). The data are shown as mean ± SEM. Values with different lowercase letters are significantly different (P ≤ 0.05).

      Transporters of AA

      Figures 3D and 3E show the relative mRNA abundance and protein expression of LAT1 and ASCT2, respectively. As compared with the control, the relative mRNA abundance and protein expression of LAT1 were lower in the H2O2 group, and the relative mRNA expression of LAT1 in the l-Trp group was higher (P < 0.05). Moreover, the relative mRNA abundance and protein expression of LAT1 in the H2O2 + l-Trp group was higher than in the H2O2 group (P < 0.05). The relative mRNA abundance and protein expression of ASCT2 decreased in the H2O2 group as compared with control (P < 0.05). The H2O2 + l-Trp group had higher relative mRNA abundance and protein expression of ASCT2 than the H2O2 group (P < 0.05).

      mTOR-S6K1/4EBP1

      As compared with the control, the relative mRNA expression and the ratio of the phosphorylated to total mTOR, 4EBP1, and S6K1 were decreased in H2O2 treatment (P < 0.05), as Figures 4A, 4B, and 4C show, and the l-Trp treatment had higher relative mRNA expression of S6K1 (P < 0.05). In addition, the relative mRNA expression and the ratio of the phosphorylated to total mTOR, 4EBP1, and S6K1 increased in H2O2 + l-Trp treatment compared with H2O2 treatment (P < 0.05).
      Figure thumbnail gr4
      Figure 4Effects of l-Trp on mammalian target of rapamycin (mTOR) signal pathway in bovine intestinal epithelial cells (BIEC) mediated by hydrogen peroxide (H2O2). Cells were treated with l-Trp (0 and 0.8 mM) combined with or without H2O2 (1 mM) for 2 h. The relative mRNA abundance and ratio of the phosphorylated (P) to total (T) mTOR signal pathway factors were measured using real-time PCR and Western blot, respectively. (A) The relative mRNA abundance of mTOR and the ratio of the phosphorylated to total mTOR. (B) The relative mRNA abundance of ribosomal protein S6 kinase 1 (S6K1) and the ratio of the phosphorylated to total S6K1. (C) The relative mRNA abundance of eukaryotic initiation factor 4E-binding protein (4EBP1) and the ratio of the phosphorylated to total 4EBP1. The data are shown as mean ± SEM. The values with different lowercase letters are significantly different (P ≤ 0.05).

      Inhibition of mTOR Affected the l-Trp-Mediated mTOR Phosphorylation and Antioxidant Enzymes in BIEC

      The ratio of the phosphorylated to total mTOR was depressed with inhibitor treated (P < 0.05), as Figure 5A shows. Although l-Trp increased the ratio of the phosphorylated to total mTOR in H2O2-mediated BIEC (P < 0.05), l-Trp did not change that ratio in H2O2-mediated BIEC with an inhibitor. The mTOR inhibitor did not affect the enzyme activities of CAT or SOD (Figures 5B and 5C, respectively). CAT and SOD enzyme activities decreased with or without the inhibitor in H2O2-mediated BIEC (P < 0.05). In addition, l-Trp increased the enzyme activities of CAT and SOD in H2O2-mediated BIEC (P < 0.05), and l-Trp did not increase the enzyme activities of CAT and SOD with the presence of an inhibitor in H2O2-mediated BIEC.
      Figure thumbnail gr5
      Figure 5l-Tryptophan enhanced antioxidative capacity through mammalian target of rapamycin (mTOR) in bovine intestinal epithelial cells (BIEC) mediated by hydrogen peroxide (H2O2). Cells were incubated with rapamycin (Rapa), H2O2, and l-Trp as the following treatments for 2 h. The treatments were control, Rapa, H2O2, H2O2 + Rapa, l-Trp + H2O2, l-Trp + H2O2 + Rapa. The concentrations of l-Trp, H2O2, and Rapa used were 0.8, 1, and 10 nM, respectively. (A) The ratio of the phosphorylated (P) to total (T) mTOR was measured using Western blot. The results were normalized to protein expression. mgprot = milligrams of protein. (B and C) The activities of catalase (CAT) and superoxide dismutase (SOD). (D and E) The relative protein expression of large neutral amino acid transporter 1 (LAT1) and alanine-serine-cysteine transporter 2 (ASCT2). The activities of CAT and SOD were normalized to protein concentration. The data are shown as mean ± SEM. The values with different lowercase letters are significantly different (P ≤ 0.05).
      Figures 5D and 5E show the effects of the mTOR inhibitor on relative protein expression of LAT1 and ASCT2, respectively. The mTOR inhibitor depressed the LAT1 expression as compared with the control (P < 0.05). The mTOR inhibitor depressed LAT1 expression in H2O2-mediated BIEC with l-Trp (P < 0.05), but not in H2O2-mediated BIEC. l-Trp increased LAT1 expression in the presence of the inhibitor in H2O2-mediated BIEC (P < 0.05). With or without H2O2 mediation, the mTOR inhibitor did not change ASCT2 expression, and l-Trp increased ASCT2 expression in H2O2-mediated BIEC with or without the present of an inhibitor (P < 0.05).

      DISCUSSION

      This study used immortalized BIEC to investigate the effects of l-Trp supplementation on antioxidative capacity, cell apoptosis, expression of AA transporters, and mTOR signal in BIEC mediated by H2O2. In addition, it explored the underlying mechanism by which l-Trp alleviated oxidative stress.
      Usually, the generation and elimination of free radicals, mainly ROS, are in dynamic equilibrium. Oxidative stress is an imbalance between defensive potential (ability), both enzymatic system and nonenzymatic antioxidants, and the free radicals. H2O2 has been widely used to induce oxidative stress in bovine epithelial cells (
      • Sun X.
      • Chang R.
      • Tang Y.
      • Luo S.
      • Jiang C.
      • Jia H.
      • Xu Q.
      • Dong Z.
      • Liang Y.
      • Loor J.J.
      • Xu C.
      Transcription factor EB (TFEB)-mediated autophagy protects bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.
      ;
      • Mao H.
      • Zhang Y.
      • Ji W.
      • Yun Y.
      • Wei X.
      • Cui Y.
      • Wang C.
      Leucine protects bovine intestinal epithelial cells from hydrogen peroxide-induced apoptosis by alleviating oxidative damage.
      ). Cell viability, concentration of LDH in supernatant, and percentage of apoptosis, together with intracellular T-AOC and SOD, GPX, and CAT activities, are key and common indicators to evaluate cells' oxidative status. In this study, H2O2–induced oxidative stress caused decreased cell viability, increased the percentage of apoptosis, and depressed antioxidant capacity, as we expected.
      Based on our observation, the effect of l-Trp on cell viability in BIEC was relevant to the concentration of l-Trp.
      • Wang H.
      • Ji Y.
      • Wu G.
      • Sun K.
      • Sun Y.
      • Li W.
      • Wang B.
      • He B.
      • Zhang Q.
      • Dai Z.
      • Wu Z.
      L-tryptophan activates mammalian target of rapamycin and enhances expression of tight junction proteins in intestinal porcine epithelial cells.
      found a similar trend, in which the cell viability of intestinal porcine epithelial cell line 1 was increased by l-Trp treatments (0.4 and 0.8 mM). Epithelial cells and lumen microbes break down dietary Trp into metabolites for use by the gastrointestinal tract (
      • Dai Z.L.
      • Wu G.
      • Zhu W.Y.
      Amino acid metabolism in intestinal bacteria: Links between gut ecology and host health.
      ;
      • Grifka-Walk H.M.
      • Jenkins B.R.
      • Kominsky D.J.
      Amino acid Trp: the far out impacts of host and commensal tryptophan metabolism.
      ), although we did not measure the concentrations of l-Trp or metabolites in medium and cells. We presumed the effect on cell viability would be associated with the activation of mTOR, which proved to play important roles in cell proliferation, protein synthesis, and so on (
      • Dowling R.J.
      • Topisirovic I.
      • Alain T.
      • Bidinosti M.
      • Fonseca B.D.
      • Petroulakis E.
      • Wang X.
      • Larsson O.
      • Selvaraj A.
      • Liu Y.
      • Kozma S.C.
      • Thomas G.
      • Sonenberg N.
      mTORC1-mediated cell proliferation, but not cell growth, controlled by the 4E-BPs.
      ). Our study also found that l-Trp elevated the mTOR.
      In addition, l-Trp supplementation decreased the percentage of apoptosis, enhanced the antioxidant capacity, and elevated the expression of AA transporters in BIEC challenged by H2O2, indicating that l-Trp might alleviate oxidative injury by decreasing apoptosis and enhancing antioxidant capacity, and thus maintain the intestinal function. Previous studies have demonstrated that Trp could act as an effective antioxidant (
      • Nayak B.N.
      • Buttar H.S.
      Evaluation of the antioxidant properties of tryptophan and its metabolites in in vitro assay.
      ;
      • Xu K.
      • Liu G.
      • Fu C.
      The tryptophan pathway targeting antioxidant capacity in the placenta.
      ). The amino group in the molecular structure of Trp could be combined with H2O2 for deaminated oxidation, thereby hindering the occurrence of oxidation reactions to a certain extent and reducing the content of free radicals (
      • Wu G.
      Amino acids: Metabolism, functions, and nutrition.
      ). Amino acid uptake is conducted by various transporters, and net uptake was affected by the number and affinity of transporters. The transporters can be regulated by hormones, physiological conditions, substrates, and so on. AA transporters were summarized and presented in
      • Kandasamy P.
      • Gyimesi G.
      • Kanai Y.
      • Hediger M.A.
      Amino acid transporters revisited: New views in health and disease.
      .
      In this study, we measured the transporters LAT1 and ASCT2 in BIEC, which were elevated by l-Trp treatment. The increased expression of transporters might be partly a result of substrate stimulation. The results of mTOR inhibition suggested that the elevation of transporter LAT1 would be partly because of mTOR activation, hence the protein synthesis. We also measured mTOR signaling pathway to confirm our speculation. The discussion is presented below. In addition, the mTOR inhibition results indicated that transporter ASCT2 elevation by l-Trp would be irrelevant to the mTOR. Nevertheless, the increased expression of AA transporters (LAT1 and ASCT2) by l-Trp suggested that l-Trp could protect the BIEC from oxidative damage, thereby maintaining the function of AA transporters and further supporting the supplementation of l-Trp in BIEC.
      The serine-threonine protein kinase mTOR is mainly affected by stress, energy status, and oxygen signals, thereby coordinating autophagy, growth, and macromolecule synthesis. The process outputs were S6K1 and 4EBP1, and so on (
      • Ma X.M.
      • Blenis J.
      Molecular mechanisms of mTOR-mediated translational control.
      ). Oxidative stress ordinarily inhibits mTOR, and this study also found decreases in the ratio of the phosphorylated to total 4EBP1 and S6K1, which was in accordance with
      • Kimball S.R.
      • Abbas A.
      • Jefferson L.S.
      Melatonin represses oxidative stress- induced activation of the MAP kinase and mTOR signaling pathways in H4IIE hepatoma cells through inhibition of Ras.
      and
      • Rohowetz L.J.
      • Kraus J.G.
      • Koulen P.
      Reactive oxygen species-mediated damage of retinal neurons: drug development targets for therapies of chronic neurodegeneration of the retina.
      . Persistent activation of mTOR could initiate protein synthesis and protect the mitochondria from oxidative stress in β cells, thus strengthening mitochondria capacity and function (
      • Wang J.
      • Yang X.
      • Zhang J.
      Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic β cells.
      ). Under oxidative stress, the mTOR was elevated by l-Trp, but no difference was found under normal conditions, suggesting the elevation of mTOR might be a result of alleviated oxidative stress and substrate stimulation. Consistent with the mTOR activation, l-Trp also increased the ratio of the phosphorylated to total 4EBP1 under oxidative stress. In addition, l-Trp increased S6K1 with or without oxidative stress. The depressed mTOR signaling pathway because of oxidative stress was activated by l-Trp, further suggesting that the rate of protein synthesis in BIEC might be enhanced, and the rate of intracellular proteolysis might be reduced (
      • Wang H.
      • Ji Y.
      • Wu G.
      • Sun K.
      • Sun Y.
      • Li W.
      • Wang B.
      • He B.
      • Zhang Q.
      • Dai Z.
      • Wu Z.
      L-tryptophan activates mammalian target of rapamycin and enhances expression of tight junction proteins in intestinal porcine epithelial cells.
      ). Moreover, as mentioned in
      • Shen Y.B.
      • Voilque G.
      • Odle J.
      • Kim S.W.
      Dietary L-tryptophan supple- mentation with reduced large neutral amino acids enhances feed efficiency and decreases stress hormone secretion in nursery pigs under social-mixing stress.
      , the small intestinal epithelial cells have a high metabolic rate and a short half-life, so the regulatory effect of Trp on protein turnover in intestine is highly effective, further enhancing the expression of tight junction proteins and improving feed efficiency and growth performance (
      • Shen Y.B.
      • Voilque G.
      • Odle J.
      • Kim S.W.
      Dietary L-tryptophan supple- mentation with reduced large neutral amino acids enhances feed efficiency and decreases stress hormone secretion in nursery pigs under social-mixing stress.
      ,
      • Shen Y.B.
      • Voilque G.
      • Kim J.D.
      • Odle J.
      • Kim S.W.
      Effects of increasing tryptophan intake on growth and physiological changes in nursery pigs.
      ;
      • Wang H.
      • Ji Y.
      • Wu G.
      • Sun K.
      • Sun Y.
      • Li W.
      • Wang B.
      • He B.
      • Zhang Q.
      • Dai Z.
      • Wu Z.
      L-tryptophan activates mammalian target of rapamycin and enhances expression of tight junction proteins in intestinal porcine epithelial cells.
      ).
      As we discussed previously, l-Trp contributed to the enzymatic antioxidants in alleviating oxidative stress in BIEC. The interesting finding in this study was that the alleviation by l-Trp might be relevant to mTOR activation. When the mTOR was inhibited by the specific inhibitor, the l-Trp could not activate the mTOR, and the enzymatic antioxidants were unchanged. The enzymatic antioxidants, such as SOD, GPX, and CAT, were mainly regulated by nuclear factor erythroid 2–related factor 2 (Nrf2)/antioxidant response element (ARE) pathway (
      • Kensler T.W.
      • Wakabayashi N.
      • Biswal S.
      Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway.
      ), and play a significant role in cellular defense systems against oxidative stress. This finding was in accordance with
      • Jiang W.D.
      • Wen H.L.
      • Liu Y.
      • Jiang J.
      • Wu P.
      • Zhao J.
      • Kuang S.Y.
      • Tang L.
      • Tang W.N.
      • Zhang Y.A.
      • Zhou X.Q.
      • Feng L.
      Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): avoid tryptophan deficiency or excess.
      , in which Trp enhanced GSH and GPX levels, and the increased antioxidant capacity was shown to be associated with Nrf2/ARE and mTOR pathways. Inhibiting the mTOR in mouse embryonic fibroblasts, suppressed the phosphorylation of p62 and the expression of the Nrf2 targeted HO-1 (
      • Ichimura Y.
      • Waguri S.
      • Sou Y.S.
      • Kageyama S.
      • Hasegawa J.
      • Ishimura R.
      • Saito T.
      • Yang Y.
      • Kouno T.
      • Fukutomi T.
      • Hoshii T.
      • Hirao A.
      • Takagi K.
      • Mizushima T.
      • Motohashi H.
      • Lee M.S.
      • Yoshimori T.
      • Tanaka K.
      • Yamamoto M.
      • Komatsu M.
      Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy.
      ). Some studies have presented that the activation of mTOR can lead to the activation of the Keap-Nrf2/ARE pathway in a p62–dependent manner (
      • Bae S.H.
      • Sung S.H.
      • Oh S.Y.
      • Lim J.M.
      • Lee S.K.
      • Park Y.N.
      • Lee H.E.
      • Kang D.
      • Rhee S.G.
      Sestrins activate Nrf2 by promoting p62-dependent autophagic degradation of Keap1 and prevent oxidative liver damage.
      ). In addition, the downregulation of Nrf2 caused the ATP deficit, leading to the activation of AMPK and negatively regulating mTOR (
      • Jia Y.
      • Wang H.
      • Wang Q.
      • Ding H.
      • Wu H.
      • Pan H.
      Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition.
      ;
      • Gureev A.P.
      • Popov V.N.
      • Starkov A.A.
      Crosstalk between the mTOR and Nrf2/ARE signaling pathways as a target in the improvement of long-term potentiation.
      ). The Nrf2 can directly regulate the promoter of the mTOR gene where the ARE sequence was identified (
      • Bendavit G.
      • Aboulkassim T.
      • Hilmi K.
      • Shah S.
      • Batist G.
      Nrf2 transcription factor can directly regulate mTOR: Linking cytoprotective gene expression to a major metabolic regulator that generates redox activity.
      ). Accordingly, we presumed l-Trp could activate the mTOR and Nrf2/ARE pathways in BIEC challenged by oxidative stress, which needed further validation.
      The ROS was shown to activate protein kinase B (Akt), further leading to mTOR phosphorylation and autophagy suppression (
      • Dai P.
      • Mao Y.
      • Sun X.
      • Li X.
      • Muhammad I.
      • Gu W.
      • Zhang D.
      • Zhou Y.
      • Ma J.
      • Ni Z.
      • Huang S.
      Attenuation of oxidative stress-induced osteoblast apoptosis by curcumin is associated with preservation of mitochondrial functions and increased Akt-GSK3β signaling.
      ;
      • Rohowetz L.J.
      • Kraus J.G.
      • Koulen P.
      Reactive oxygen species-mediated damage of retinal neurons: drug development targets for therapies of chronic neurodegeneration of the retina.
      ), and the autophagy activation through Akt-mTOR signaling contributed to the anti-apoptotic effect to combat oxidative stress (
      • Shi Y.
      • Liu X.Y.
      • Jiang Y.P.
      • Zhang J.B.
      • Zhang Q.Y.
      • Wang N.N.
      • Xin H.L.
      Monotropein attenuates oxidative stress via Akt/mTOR-mediated autophagy in osteoblast cells.
      ). As we mentioned previously, the percentage of apoptosis was decreased with l-Trp treatment under oxidative stress. These findings might suggest that the l-Trp could alleviate oxidative stress through autophagy activation. Further study is warranted to verify the inference.

      CONCLUSIONS

      The present study demonstrated that l-Trp alleviated oxidative injury in H2O2-mediated BIEC via promoting antioxidative capacity and depressing apoptosis, thus maintaining intestinal function. l-Tryptophan could also regulate the mTOR signaling pathway. Furthermore, this study provides insights into nutritional regulation mechanism of l-Trp in body metabolism.

      ACKNOWLEDGMENTS

      Financial support was received from the National Natural Science Foundation of China (32172742 and 32202688), the Natural Science Foundation of Zhejiang Province (LQ22C170002; China), the Cooperative Extension Plan of Major Agricultural Technologies of Zhejiang Province (2019XTTGXM02-3; China), and the Scientific Research Training Program of Zhejiang Agriculture and Forestry University (2021KX0118; China). We are grateful to all the members of Chong Wang's laboratory (Zhejiang A&F University, Zhejiang, China) for providing valuable assistance in sample measurement and data analysis, and to William E. Gregory (Northwest A&F University) for editing the English grammar. The authors have not stated any conflicts of interest.

      REFERENCES

        • Bae S.H.
        • Sung S.H.
        • Oh S.Y.
        • Lim J.M.
        • Lee S.K.
        • Park Y.N.
        • Lee H.E.
        • Kang D.
        • Rhee S.G.
        Sestrins activate Nrf2 by promoting p62-dependent autophagic degradation of Keap1 and prevent oxidative liver damage.
        Cell Metab. 2013; 17 (23274085): 73-84
        • Bendavit G.
        • Aboulkassim T.
        • Hilmi K.
        • Shah S.
        • Batist G.
        Nrf2 transcription factor can directly regulate mTOR: Linking cytoprotective gene expression to a major metabolic regulator that generates redox activity.
        J. Biol. Chem. 2016; 291 (27784786): 25476-25488
        • Bender D.A.
        Biochemistry of tryptophan in health and disease.
        Mol. Aspects Med. 1983; 6 (6371429): 101-197
        • Bordignon R.
        • Volpato A.
        • Glombowsky P.
        • Souza C.F.
        • Baldissera M.D.
        • Secco R.
        • Pereira W.A.B.
        • Leal M.L.R.
        • Vedovatto M.
        • Da Silva A.S.
        Nutraceutical effect of vitamins and minerals on performance and immune and antioxidant systems in dairy calves during the nutritional transition period in summer.
        J. Therm. Biol. 2019; 84 (31466786): 451-459
        • Dai P.
        • Mao Y.
        • Sun X.
        • Li X.
        • Muhammad I.
        • Gu W.
        • Zhang D.
        • Zhou Y.
        • Ma J.
        • Ni Z.
        • Huang S.
        Attenuation of oxidative stress-induced osteoblast apoptosis by curcumin is associated with preservation of mitochondrial functions and increased Akt-GSK3β signaling.
        Cell. Physiol. Biochem. 2017; 41 (28291961): 661-677
        • Dai Z.L.
        • Wu G.
        • Zhu W.Y.
        Amino acid metabolism in intestinal bacteria: Links between gut ecology and host health.
        Front. Biosci. (Landmark Ed.). 2011; 16 (21196263): 1768-1786
        • Dowling R.J.
        • Topisirovic I.
        • Alain T.
        • Bidinosti M.
        • Fonseca B.D.
        • Petroulakis E.
        • Wang X.
        • Larsson O.
        • Selvaraj A.
        • Liu Y.
        • Kozma S.C.
        • Thomas G.
        • Sonenberg N.
        mTORC1-mediated cell proliferation, but not cell growth, controlled by the 4E-BPs.
        Science. 2010; 328 (20508131): 1172-1176
        • Grifka-Walk H.M.
        • Jenkins B.R.
        • Kominsky D.J.
        Amino acid Trp: the far out impacts of host and commensal tryptophan metabolism.
        Front. Immunol. 2021; 12 (34149693)653208
        • Guo L.
        • Liang Z.
        • Zheng C.
        • Liu B.
        • Yin Q.
        • Cao Y.
        • Yao J.
        Leucine affects α-amylase synthesis through PI3K/Akt-mTOR signaling pathways in pancreatic acinar cells of dairy calves.
        J. Agric. Food Chem. 2018; 66 (29733580): 5149-5156
        • Gureev A.P.
        • Popov V.N.
        • Starkov A.A.
        Crosstalk between the mTOR and Nrf2/ARE signaling pathways as a target in the improvement of long-term potentiation.
        Exp. Neurol. 2020; 328 (32165256)113285
        • Ichimura Y.
        • Waguri S.
        • Sou Y.S.
        • Kageyama S.
        • Hasegawa J.
        • Ishimura R.
        • Saito T.
        • Yang Y.
        • Kouno T.
        • Fukutomi T.
        • Hoshii T.
        • Hirao A.
        • Takagi K.
        • Mizushima T.
        • Motohashi H.
        • Lee M.S.
        • Yoshimori T.
        • Tanaka K.
        • Yamamoto M.
        • Komatsu M.
        Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy.
        Mol. Cell. 2013; 51 (24011591): 618-631
        • Jia Y.
        • Wang H.
        • Wang Q.
        • Ding H.
        • Wu H.
        • Pan H.
        Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition.
        Biochem. Biophys. Res. Commun. 2016; 469 (26692480): 665-671
        • Jiang W.D.
        • Wen H.L.
        • Liu Y.
        • Jiang J.
        • Wu P.
        • Zhao J.
        • Kuang S.Y.
        • Tang L.
        • Tang W.N.
        • Zhang Y.A.
        • Zhou X.Q.
        • Feng L.
        Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): avoid tryptophan deficiency or excess.
        Food Chem. 2016; 199 (26775963): 210-219
        • Kandasamy P.
        • Gyimesi G.
        • Kanai Y.
        • Hediger M.A.
        Amino acid transporters revisited: New views in health and disease.
        Trends Biochem. Sci. 2018; 43 (30177408): 752-789
        • Kensler T.W.
        • Wakabayashi N.
        • Biswal S.
        Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway.
        Annu. Rev. Pharmacol. Toxicol. 2007; 47 (16968214): 89-116
        • Kimball S.R.
        • Abbas A.
        • Jefferson L.S.
        Melatonin represses oxidative stress- induced activation of the MAP kinase and mTOR signaling pathways in H4IIE hepatoma cells through inhibition of Ras.
        J. Pineal Res. 2008; 44 (18410586): 379-386
        • Lan R.
        • Chang Q.
        • Wei L.
        • Zhao Z.
        The protect effects of chitosan oligosaccharides on intestinal integrity by regulating oxidative status and inflammation under oxidative stress.
        Mar. Drugs. 2021; 19 (33503912): 57
        • Li C.
        • Wang W.
        • Liu T.
        • Zhang Q.
        • Wang G.
        • Li F.
        • Li F.
        • Yue X.
        • Li T.
        Effect of early weaning on the intestinal microbiota and expression of genes related to barrier function in lambs.
        Front. Microbiol. 2018; 9 (30013534)1431
        • Lykkesfeldt J.
        • Svendsen O.
        Oxidants and antioxidants in disease: Oxidative stress in farm animals.
        Vet. J. 2007; 173 (16914330): 502-511
        • Ma X.M.
        • Blenis J.
        Molecular mechanisms of mTOR-mediated translational control.
        Nat. Rev. Mol. Cell Biol. 2009; 10 (19339977): 307-318
        • Mao H.
        • Zhang Y.
        • Ji W.
        • Yun Y.
        • Wei X.
        • Cui Y.
        • Wang C.
        Leucine protects bovine intestinal epithelial cells from hydrogen peroxide-induced apoptosis by alleviating oxidative damage.
        J. Sci. Food Agric. 2022; (jsfa.11941) (35437753)
        • Nayak B.N.
        • Buttar H.S.
        Evaluation of the antioxidant properties of tryptophan and its metabolites in in vitro assay.
        J. Complement. Integr. Med. 2016; 13 (26641976): 129-136
        • Oxenkrug G.F.
        Genetic and hormonal regulation of tryptophan-kynurenine metabolism: implications for vascular cognitive impairment, major depressive disorder, and aging.
        Ann. N. Y. Acad. Sci. 2007; 1122 (18077563): 35-49
        • Petzel E.A.
        • Acharya S.
        • Bailey E.A.
        • Brake D.W.
        Effects of polymerization of casein and sources of lysine on amino acid bioavailability among calves fed liquid-based diets.
        J. Dairy Sci. 2021; 104 (33741162): 6779-6791
        • Rohowetz L.J.
        • Kraus J.G.
        • Koulen P.
        Reactive oxygen species-mediated damage of retinal neurons: drug development targets for therapies of chronic neurodegeneration of the retina.
        Int. J. Mol. Sci. 2018; 19 (30373222)3362
        • Shen Y.B.
        • Voilque G.
        • Odle J.
        • Kim S.W.
        Dietary L-tryptophan supple- mentation with reduced large neutral amino acids enhances feed efficiency and decreases stress hormone secretion in nursery pigs under social-mixing stress.
        J. Nutr. 2012; 142 (22739380): 1540-1546
        • Shen Y.B.
        • Voilque G.
        • Kim J.D.
        • Odle J.
        • Kim S.W.
        Effects of increasing tryptophan intake on growth and physiological changes in nursery pigs.
        J. Anim. Sci. 2012; 90 (22287672): 2264-2275
        • Shi Y.
        • Liu X.Y.
        • Jiang Y.P.
        • Zhang J.B.
        • Zhang Q.Y.
        • Wang N.N.
        • Xin H.L.
        Monotropein attenuates oxidative stress via Akt/mTOR-mediated autophagy in osteoblast cells.
        Biomed. Pharmacother. 2020; 121 (31698268)109566
        • Sottero B.
        • Rossin D.
        • Poli G.
        • Biasi F.
        Lipid oxidation products in the pathogenesis of inflammation-related gut diseases.
        Curr. Med. Chem. 2018; 25 (28625152): 1311-1326
        • Sun X.
        • Chang R.
        • Tang Y.
        • Luo S.
        • Jiang C.
        • Jia H.
        • Xu Q.
        • Dong Z.
        • Liang Y.
        • Loor J.J.
        • Xu C.
        Transcription factor EB (TFEB)-mediated autophagy protects bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.
        J. Anim. Sci. Biotechnol. 2021; 12 (33685494): 35
        • Suzuki T.
        Regulation of the intestinal barrier by nutrients: The role of tight junctions.
        Anim. Sci. J. 2020; 91 (32219956)e13357
        • Vandesompele J.
        • De Preter K.
        • Pattyn F.
        • Poppe B.
        • Van Roy N.
        • De Paepe A.
        • Speleman F.
        Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.
        Genome Biol. 2002; 3research0034.1
        • Wang H.
        • Ji Y.
        • Wu G.
        • Sun K.
        • Sun Y.
        • Li W.
        • Wang B.
        • He B.
        • Zhang Q.
        • Dai Z.
        • Wu Z.
        L-tryptophan activates mammalian target of rapamycin and enhances expression of tight junction proteins in intestinal porcine epithelial cells.
        J. Nutr. 2015; 145 (25878205): 1156-1162
        • Wang J.
        • Yang X.
        • Zhang J.
        Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic β cells.
        Cell. Signal. 2016; 28 (27185188): 1099-1104
        • Wei X.S.
        • Zhao H.H.
        • He J.J.
        • Yin Q.Y.
        • Cao Y.C.
        • Cai C.J.
        • Yao J.H.
        Maternal nicotinamide supplementation during the perinatal period modifies the small intestine morphology and antioxidative status of offspring kids.
        Anim. Feed Sci. Technol. 2019; 252: 41-50
        • Wood K.M.
        • Palmer S.I.
        • Steele M.A.
        • Metcalf J.A.
        • Penner G.B.
        The influence of age and weaning on permeability of the gastrointestinal tract in Holstein bull calves.
        J. Dairy Sci. 2015; 98 (26278496): 7226-7237
        • Wu G.
        Amino acids: Metabolism, functions, and nutrition.
        Amino Acids. 2009; 37: 1-17
        • Xu K.
        • Liu G.
        • Fu C.
        The tryptophan pathway targeting antioxidant capacity in the placenta.
        Oxid. Med. Cell. Longev. 2018; 2018 (30140360)1054797
        • Yeste N.
        • Bassols A.
        • Vidal M.
        • Bach A.
        • Terré M.
        Evaluating the potential role of tryptophan in calf milk replacers to facilitate weaning.
        J. Dairy Sci. 2020; 103 (32475660): 7009-7017
        • Zhan K.
        • Lin M.
        • Liu M.M.
        • Sui Y.N.
        • Zhao G.Q.
        Establishment of primary bovine intestinal epithelial cell culture and clone method.
        In Vitro Cell. Dev. Biol. Anim. 2017; 53 (27561890): 54-57
        • Zhan K.
        • Yang T.Y.
        • Chen Y.
        • Jiang M.C.
        • Zhao G.Q.
        Propionate enhances the expression of key genes involved in the gluconeogenic pathway in bovine intestinal epithelial cells.
        J. Dairy Sci. 2020; 103 (32278554): 5514-5524
        • Zhang H.
        • Liu X.
        • Fan Y.
        • Yu Y.
        • Loor J.J.
        • Elsabagh M.
        • Peng A.
        • Wang H.
        L-Arginine alleviates hydrogen peroxide-induced oxidative damage in ovine intestinal epithelial cells by regulating apoptosis, mitochondrial function, and autophagy.
        J. Nutr. 2021; 151 (33693729): 1038-1046