Advertisement

Preparation of silver nanoparticles/polymethylmethacrylate/cellulose acetate film and its inhibitory effect on Cronobacter sakazakii in infant formula milk

Open AccessPublished:November 07, 2022DOI:https://doi.org/10.3168/jds.2022-22246

      ABSTRACT

      Cronobacter sakazakii is a harmful foodborne pathogen, and its contaminated food will pose a huge threat to human health. Prevention of C. sakazakii contamination of food is valuable for food safety as well as for human health. In this study, silver nanoparticles (AgNP) were successfully immobilized on the surface of cellulose acetate (CA) and polymethylmethacrylate (PMMA) composite to obtain AgNP/PMMA/CA film. Through the inhibition zone and growth curve experiments, we found that AgNP/PMMA/CA films has excellent antibacterial activity on C. sakazakii. The AgNP/PMMA/CA film can prolong the lag phase of the growth curve of C. sakazakii from 2 to 8 h. The antibacterial films were found to reduce the survival of C. sakazakii in Luria-Bertani and infant formula by combining it with a mild heat treatment (45°C, 50°C, and 55°C). The AgNP/PMMA/CA film combined with 55°C water bath can completely inactivate C. sakazakii in infant formula within 120 min. Finally, the potential mechanism by which AgNP/PMMA/CA films reduce the heat tolerance of C. sakazakii was investigated by quantitative real-time PCR. The results showed that AgNP/PMMA/CA films could reduce the expression of environmental tolerance-related genes in C. sakazakii. The current research shows that AgNP/PMMA/CA film has strong antibacterial activity, and the antibacterial film combined with mild heat treatment can accelerate the inactivation of C. sakazakii and effectively reduce the harm of foodborne pathogens. The AgNP/PMMA/CA film can be used as a potential packaging material or antibacterial surface coating.

      Key words

      INTRODUCTION

      Cronobacter spp., formerly known as Enterobacter sakazakii, is a gram-negative bacillus that parasitizes in the intestinal tract of humans and animals, and is also an important foodborne pathogen (
      • Nazarowec-White M.
      • Farber J.
      Enterobacter sakazakii: A review.
      ). Cronobacter sakazakii can cause necrotizing enterocolitis, sepsis, and meningitis in infants with a fatality rate more than 40%, and a small number of survivors would develop very serious neurological complications (
      • Lampel K.A.
      • Chen Y.
      Method for the isolation and detection of Enterobacter sakazakii (Cronobacter) from powdered infant formula.
      ). Infants are at risk of contracting C. sakazakii through consumption of infant formula milk powder (IFM) or other utensils contaminated with C. sakazakii (
      • Hunter C.J.
      • Petrosyan M.
      • Ford H.R.
      • Prasadarao N.V.
      Enterobacter sakazakii: An emerging pathogen in infants and neonates.
      ). Some strains of C. sakazakii present in IFM are biofilm-forming, pathogenic, and are highly resistant to environmental stresses such as high osmotic pressure, low pH, high temperature, oxidation, and desiccation, making it difficult to inactivate C. sakazakii in contaminated food (
      • Ling N.
      • Forsythe S.
      • Wu Q.
      • Ding Y.
      • Zhang J.
      • Zeng H.
      Insights into Cronobacter sakazakii biofilm formation and control strategies in the food industry.
      ). Therefore, it is particularly important to effectively prevent and control pathogenic bacteria from the source of pollution.
      Nano-inorganic antimicrobial agents are a new type of antimicrobial agents that are more broad-spectrum, durable, and safe than organic antimicrobial agents. Among inorganic antibacterial agents, silver nanoparticles (AgNP) have been widely used due to their low toxicity, high antibacterial activity, and broad antibacterial spectrum (
      • Rai M.
      • Yadav A.
      • Gade A.
      Silver nanoparticles as a new generation of antimicrobials.
      ). The researchers also combined AgNP with other polymer materials to form a silver-loaded antibacterial composite material, which can reduce the dissolution of AgNP in the aqueous solution and improve the antibacterial properties of the composite material (
      • Sadeghnejad A.
      • Aroujalian A.
      • Raisi A.
      • Fazel S.
      Antibacterial nano silver coating on the surface of polyethylene films using corona discharge.
      ;
      • Fernando S.
      • Gunasekara T.
      • Holton J.
      Antimicrobial nanoparticles: Applications and mechanisms of action.
      ).
      • Jiang Q.
      • Luo B.
      • Wu Z.
      • Wang X.
      Antibacterial composite paper with corn stalk-based carbon spheres immobilized AgNPs.
      prepared an AgNP-loaded nanocellulose fiber and chitosan composite film, and the obtained nanocellulose fiber/AgNP/chitosan film showed an excellent antibacterial activity against Escherichia coli and Staphylococcus aureus.
      • Wang W.
      • Yu Z.
      • Alsammarraie F.K.
      • Kong F.
      • Lin M.
      • Mustapha A.
      Properties and antimicrobial activity of polyvinyl alcohol-modified bacterial nanocellulose packaging films incorporated with silver nanoparticles.
      combined AgNP with bacterial nanocellulose by reduction and UV irradiation-assisted methods to prepare an environmentally friendly antibacterial membrane, which was effective against E. coli. The film material is also biodegradable, which will reduce the environmental pollution caused by nonbiodegradable synthetic packaging materials.
      Bio-based nanocomposites are considered as ideal materials for the preparation of antibacterial food packaging. Cellulose acetate (CA) is an environmentally friendly polymer extracted from cellulose, which can form a film at room temperature, is odorless, nontoxic, biodegradable, insoluble in water, has the small affinity for water vapor, and it is considered to be a promising food packaging material (
      • Gemili S.
      • Yemenicioğlu A.
      • Altınkaya S.A.
      Development of cellulose acetate based antimicrobial food packaging materials for controlled release of lysozyme.
      ;
      • Puls J.
      • Wilson S.A.
      • Hölter D.
      Degradation of cellulose acetate-based materials: A review.
      ;
      • Gouvêa D.M.
      • Mendonça R.C.S.
      • Soto M.L.
      • Cruz R.S.
      Acetate cellulose film with bacteriophages for potential antimicrobial use in food packaging.
      ).
      • Marrez D.A.
      • Abdelhamid A.E.
      • Darwesh O.M.
      Eco-friendly cellulose acetate green synthesized silver nano-composite as antibacterial packaging system for food safety.
      prepared an AgNP-loaded CA film with strong antibacterial activity against a variety of foodborne pathogens.
      • Beisl S.
      • Monteiro S.
      • Santos R.
      • Figueiredo A.S.
      • Sánchez-Loredo M.G.
      • Lemos M.A.
      • Lemos F.
      • Minhalma M.
      • De Pinho M.N.
      Synthesis and bactericide activity of nanofiltration composite membranes—Cellulose acetate/silver nanoparticles and cellulose acetate/silver ion exchanged zeolites.
      prepared a CA/AgNP filter membrane for water filtration treatment, which reduced the number of E. coli by more than 99.99%.
      In addition, polymethylmethacrylate (PMMA) is a common polymer material used to prepare composite antibacterial materials with AgNP, and has been widely used in medical and other antibacterial fields because of its biocompatibility (
      • Alt V.
      • Bechert T.
      • Steinrücke P.
      • Wagener M.
      • Seidel P.
      • Dingeldein E.
      • Domann E.
      • Schnettler R.
      An in vitro assessment of the antibacterial properties and cytotoxicity of nanoparticulate silver bone cement.
      ).
      • Borse S.
      • Temgire M.
      • Khan A.
      • Joshi S.
      Photochemically assisted one-pot synthesis of PMMA embedded silver nanoparticles: Antibacterial efficacy and water treatment.
      prepared an AgNP-PMMA nanocomposite that showed good bactericidal properties against E. coli and S. aureus.
      • Petrochenko P.E.
      • Zheng J.
      • Casey B.J.
      • Bayati M.R.
      • Narayan R.J.
      • Goering P.L.
      Nanosilver-PMMA composite coating optimized to provide robust antibacterial efficacy while minimizing human bone marrow stromal cell toxicity.
      prepared a PMMA/Ag composite film, which not only has a good antibacterial effect on E. coli, but also has good biocompatibility. These results indicate that the AgNP-loaded composite films have good antibacterial activity against foodborne pathogens. However, the preparation of antibacterial films using PMMA combined with CA is rarely studied. Hydrogen bonds can form between PMMA and CA, which contribute to specific interactions that promote the miscibility and mechanical properties of the mixture (
      • Bhat D.K.
      • Kumar M.S.
      Biodegradability of PMMA blends with some cellulose derivatives.
      ). Additionally, the blend of PMMA and CA has good biodegradability, so their use will not cause any environmental pollution (
      • Haider T.P.
      • Völker C.
      • Kramm J.
      • Landfester K.
      • Wurm F.R.
      Plastics of the future? The impact of biodegradable polymers on the environment and on society.
      ). Therefore, the use of PMMA combined with CA to prepare antibacterial films has a good application prospect.
      The objective of this study was to prepare an antibacterial film loaded with AgNP. The physicochemical properties, morphology, and antibacterial properties of the antibacterial films were then evaluated. Finally, the inactivation effect of AgNP/PMMA/CA film combined with mild heat treatment on C. sakazakii in Luria-Bertani (LB) and IFM medium and its potential antibacterial mechanism were explored.

      MATERIALS AND METHODS

      Materials and Reagents

      The silver nitrate (AgNO3) and sodium hydroxide (NaOH) were purchased from Sigma-Aldrich Chemical Co. Cellulose acetate was purchased from Sangon Biotech Co. Ltd. Polymethylmethacrylate was purchased from Shanghai Aladdin Biochemical Technology Co. Ltd. Tetrahydrofuran was purchased from Xilong Science Co. Ltd. The infant formula milk powder was purchased from Jiangxi Meilu, Dairy Co. Ltd. The LB medium and agar powder were purchased from Becton Dickinson. The primers were synthesized by TSINGKE Biological Technology.
      No animals were used in this study, and ethical approval for the use of animals was thus deemed unnecessary.

      Bacterial Strains and Culture Conditions.

      Cronobacter sakazakii ATCC 29544 was purchased from American Type Culture Collection The strain was stored at −40°C in LB containing 25% (vol/vol) glycerol. The strain was used in the experiment after streaking twice on fresh LB agar containing 1.5% (wt/vol) agar. Single colonies were selected for activation and subculture for 2 times to allow the bacteria to have sufficient viability before being used in subsequent experiments.

      Synthesis of AgNP/PMMA/CA Films.

      The preparation process is shown in Figure 1, 1 g of PMMA and 2 g of CA were added into 50 mL of tetrahydrofuran, respectively. After dissolution, PMMA solution and CA solution were obtained. Then, 6 mL of mixed solutions of PMMA solution and CA solution with different proportions (5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, and 1:5) were poured onto a polytetrafluoroethylene plate, and the polytetrafluoroethylene plate was placed in a fume hood to volatilize tetrahydrofuran to obtain the PMMA/CA film. Next, the obtained PMMA/CA film was washed 3 times with deionized water and air-dried, and then the film was immersed in 0.01 mol/L NaOH solution at 60°C for 2 h. Subsequently, the film was washed with deionized water for 3 times. The dried film was immersed in a 2 mg/mL of AgNO3 solution and was water bathed at 60°C for 3 h to obtain the AgNP/PMMA/CA film. Finally, the AgNP/PMMA/CA films were washed 3 times with deionized water to remove free silver ions.
      Figure thumbnail gr1
      Figure 1Preparation of AgNP/PMMA/CA film and its antibacterial strategy. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate; IFM = infant formula milk powder; LB = Luria-Bertani.

      Characterization of AgNP/PMMA/CA Films.

      The optical properties of the films were detected by UV-visible absorption (varioskan lux, Thermo Fisher Scientific) to determine whether AgNP were loaded on the films. The surface morphology of the films was observed using a scanning electron microscope (Jasam-6701f, Jeol. Ltd.). The elements in the films were analyzed using scanning electron microscope-mapping. The transmittance of the film at 700 to 3,250 cm−1 was measured by Fourier transform infrared (FT-IR) spectrometer (Nicolet iS50, Madison Thermo Fisher) to determine the interaction between the film components.

      Determination of Antibacterial Effect of AgNP/PMMA/CA Films

      Determination of the Inhibition Zone.

      To evaluate the antibacterial effect of AgNP/PMMA/CA films, the films were cut into circular slices with a diameter of 11 mm for the inhibition zone experiment. Briefly, 200 μL of 106 cfu/mL of bacterial solution was spread on LB agar plate, and then the AgNP/PMMA/CA films presterilized by UV were placed on LB agar plate coated with the bacterial solution. The control group was tested using PMMA/CA films. Then, the LB agar plate was placed at 37°C for 24 h, and the size of the inhibition zone was measured with a ruler.

      Determination of Growth Curve.

      Evaluation of the inhibitory effect of antibacterial films on the growth and reproduction of C. sakazakii by using 1 cm2 AgNP/PMMA/CA films cocultured with bacteria. Briefly, 50 μL of 107 cfu/mL bacterial solution (exponential phase) was inoculated into 5 mL of LB or IFM (m/v = 15%) medium. Then, the pre-UV sterilized film was inoculated into 5 mL of LB broth or rehydrated IFM (wt/vol = 15%), and the test tube was cultured at 37°C, 180 rpm for 30 h. The number of bacteria was counted by plate counting method, and the growth curve was drawn using software according to the counting results.

      Effects of AgNP/PMMA/CA Film Combined With Thermal Treatment on C. sakazakii.

      Due to its high heat resistance, C. sakazakii may be present in the production and processing of milk powder, which may eventually contaminate the product and cause harm to the human health. Therefore, the AgNP/PMMA/CA film combined with different temperatures (45°C, 50°C, and 55°C) was used to treat the bacterial solution to evaluate the effect of AgNP/PMMA/CA film on the heat resistance of C. sakazakii. Briefly, 50 μL of 108 cfu/mL bacterial solution (exponential phase) was inoculated into 5 mL of LB or IFM. Then, 1 cm2 of AgNP/PMMA/CA film or PMMA/CA film was added to the test tube containing the bacterial solution, and these mixtures were subjected to water bath treatment at different temperatures. Immediately after the water bath, we put the test tube containing the sample solution into the ice water prepared in advance to cool the sample solution. The number of bacteria was then counted using the plate count method.

      RNA Isolation and Quantitative Real-Time PCR Assay.

      Twelve genes (Table 1) related to the environmental stresses tolerance of C. sakazakii were used in quantitative real-time PCR (RT-qPCR) experiments. The bacterial solution cultured overnight was diluted to obtain the initial concentration of C. sakazakii, about 1.0 × 109 cfu/mL in 5 mL of LB medium, and the 1 cm2 of AgNP/PMMA/CA film or PMMA/CA film was added and cultured at 37°C, 180 rpm for 2 h. According to the manufacturer's instructions of AxyPrep Multisource Total RNA Miniprep Kit (Axygen Scientific), the total RNA was extract from the bacteria. Next, total mRNA was reversed transcription to cDNA using Takara PrimeScript RT reagent kit (Takara, Biotech Co. Ltd.). The RT-qPCR reactions were performed using the AriaMx real-time PCR system (Agilent Technologies Inc.), following 10 μL of system containing 5 μL of SYBR Premix ExTaq, 3.2 μL of sterile water, 1 μL of cDNA, and 0.8 μL (10 mM) of forward and reverse primer mixture. The RT-qPCR conditions included pre-degeneration of cDNA at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s and annealing at 56°C for 1 min. Sterile water instead of cDNA template was used as negative control. Three repeated experiments were performed on all samples.
      Table 1Genes and primers selected for quantitative real-time PCR (RT-qPCR)
      GenePrimerSequence (5′–3′)Reference
      ESA_04030
      This gene encodes 16s rRNA, which was used to normalize RT-qPCR data.
      ForwardGCCGCTGCGGACTGTATC
      • Amalaradjou M.A.R.
      • Venkitanarayanan K.
      Effect of trans-cinnamaldehyde on reducing resistance to environmental stresses in Cronobacter sakazakii..
      ReverseGCCGTCGGCATTGAATTC
      rpoSForwardTCTGGTGGTGAAGATTGCCCThis study
      ReverseGGTTCATGATTGCCCGTTCG
      groESForwardGGCCGCATCCTTGAAAATGGThis study
      ReverseCAGCACTTCCTGATCGTCCA
      hfqForwardCGGTCAGCCAGATGGTTTAT
      • Chen Y.
      • Wen Q.
      • Chen S.
      • Guo D.
      • Xu Y.
      • Liang S.
      • Xia X.
      • Yang B.
      • Shi C.
      Effect of thymoquinone on the resistance of Cronobacter sakazakii to environmental stresses and antibiotics.
      ReverseTCGGCGTCTTCGCTATCC
      grxBForwardATACCGCGCGTGAAGAGAAAThis study
      ReverseCGGTGGTATCAATGGCCTGT
      mfla-1165ForwardGCGAAATCGTGATCGAAACC
      • Amalaradjou M.A.R.
      • Venkitanarayanan K.
      Effect of trans-cinnamaldehyde on reducing resistance to environmental stresses in Cronobacter sakazakii..
      ReverseTCGCAGCCGGGTACGT
      ompAForwardTGAGCAACCTGGATCCGAAA
      • Chen Y.
      • Wen Q.
      • Chen S.
      • Guo D.
      • Xu Y.
      • Liang S.
      • Xia X.
      • Yang B.
      • Shi C.
      Effect of thymoquinone on the resistance of Cronobacter sakazakii to environmental stresses and antibiotics.
      ReverseGGAGATCTTGTTGGACGGGA
      phoPForwardTGATCTCTATGCCGCCGTTCThis study
      ReverseCTTTGCTGACAACCTTGCCC
      phoQForwardTCAACGCGAACGGTTTTCACThis study
      ReverseCGGATAGACATTGACCGCGA
      dnaKForwardTGTCTTCGCCTTTCAGGGACThis study
      ReverseAACGCTGAAGCTGACCGTAA
      dnaJForwardCGGGTCAGGTCGTCAAAGAAThis study
      ReverseTACTGTGTCGTGTCGTGGTG
      furForwardCATGTCAGTGCGGAAGACCTThis study
      ReverseCGCAATCGAGGCAAATCAGG
      1 This gene encodes 16s rRNA, which was used to normalize RT-qPCR data.

      Determination of Silver Migration.

      Silver migration in AgNP/PMMA/CA films was determined by inductively coupled plasma MS, with some modifications according to the method of
      • Cheng J.
      • Lin X.
      • Wu X.
      • Liu Q.
      • Wan S.
      • Zhang Y.
      Preparation of a multifunctional silver nanoparticles polylactic acid food packaging film using mango peel extract.
      . Briefly, 100 mg of AgNP/PMMA/CA film was immersed in 50 mL of deionized water. On alternate days, for 7 consecutive days, the 100-μL samples were extracted. After that, an equal amount of the water was refilled. Of this sample, 50 μL was added to 300 μL of concentrated nitric acid and 100 μL of perchloric acid, and digested in a water bath at 95°C for 2 h. Calibration curve was drawn for a concentration range of 2.0, 4.0, 6.0, 8.0, and 10.0 μg/kg.

      Statistical Analysis

      The experiments were independently conducted 3 times. The mean ± standard deviation was calculated from the data obtained from the 3 independent experiments. One-way or 2-way ANOVA were used by SPSS v22.0 (SPSS Inc.) for comparing the results between the different groups. The 2−ΔΔCt method was used to analyze the RT-qPCR results. Results with P < 0.05 were considered statistically significant. The graph data were processed by GraphPad Prism 8.0.2 software.

      RESULTS AND DISCUSSION

      UV-Visible Absorption Spectrum of Films

      The UV-visible absorption spectrum was used to verify whether AgNP were stable in the film. The results showed that PMMA/CA film was almost no characteristic absorption peak at a 410-nm wavelength, but the AgNP/PMMA/CA film showed it (Figure 2A), which was corresponding to the absorption peak of AgNP (
      • Rolim W.R.
      • Pelegrino M.T.
      • de Araújo Lima B.
      • Ferraz L.S.
      • Costa F.N.
      • Bernardes J.S.
      • Rodigues T.
      • Brocchi M.
      • Seabra A.B.
      Green tea extract mediated biogenic synthesis of silver nanoparticles: Characterization, cytotoxicity evaluation and antibacterial activity.
      ). The results indicated that the AgNP were stable in the film.
      Figure thumbnail gr2
      Figure 2(A) Ultraviolet-visible spectrum of the AgNP/PMMA/CA film; (B) Fourier transform infrared spectrum of the films. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate.

      Fourier Transform Infrared Spectrum

      Chemical structure and interactions between Ag and CA, and PMMA matrix were evaluated by the FT-IR presented in Figure 2B. Typically, the peak at 1,700 to 1,750 cm−1 was assigned to C=O vibrations from CA and PMMA (
      • Namouchi F.
      • Smaoui H.
      • Fourati N.
      • Zerrouki C.
      • Guermazi H.
      • Bonnet J.
      Investigation on electrical properties of thermally aged PMMA by combined use of FTIR and impedance spectroscopies.
      ;
      • Khan S.B.
      • Alamry K.A.
      • Bifari E.N.
      • Asiri A.M.
      • Yasir M.
      • Gzara L.
      • Ahmad R.Z.
      Assessment of antibacterial cellulose nanocomposites for water permeability and salt rejection.
      ). The peak at 2,800 to 3,000 cm−1 and 1,000 to 1,250 cm−1, respectively, corresponds to C–H and C–O stretching vibration (
      • Khan S.B.
      • Alamry K.A.
      • Bifari E.N.
      • Asiri A.M.
      • Yasir M.
      • Gzara L.
      • Ahmad R.Z.
      Assessment of antibacterial cellulose nanocomposites for water permeability and salt rejection.
      ). However, the normalization of all spectra to the bands located at the 2,800 to 3,000 cm−1, and obvious intensities decreasing of the peaks at 1,742, 1,380, 1,230, and 1,030 cm−1 were observed by the FT-IR spectra of the AgNP/PMMA/CA films, which might be attributed to the interactions of the AgNP with the CA matrix (
      • Kendouli S.
      • khalfallah O.
      • Sobti N.
      • Bensouissi A.
      • Avci A.
      • Eskizeybek V.
      • Achour S.
      Modification of cellulose acetate nanofibers with PVP/Ag addition.
      ). Moreover, the shifts on C=O ester carbonyl group, C–O, and C–H of AgNP/PMMA/CA nanocomposite films were shown, indicating that the AgNP modify the PMMA/CA films structure (
      • Kadhim A.
      • Humud H.R.
      • Abd Al Kareem L.
      XRD and FTIR studies for Ag/PMMA nano composite thin films.
      ). The absence of a new peak may be due to the very low content of Ag that was below the detection limit of FT-IR instruments.

      Surface Morphology of Films

      The scanning electron microscope results are shown in Figures 3A3C. The surface of PMMA/CA films was found to have a loose porous structure, which is similar to the previous reports (
      • Kamal T.
      • Ahmad I.
      • Khan S.B.
      • Asiri A.M.
      Synthesis and catalytic properties of silver nanoparticles supported on porous cellulose acetate sheets and wet-spun fibers.
      ). We found a lot of AgNP on the surface of AgNP/PMMA/CA films, and the AgNP particles are chiefly denser in the pores of the film. The loose porous structure on the surface of PMMA/CA films is favorable for the attachment of AgNP. Additionally, the average particle size of AgNP is 61.70 ± 33.7 nm. The scanning electron microscope-mapping results (Figures 3D3G) show that several elements such as carbon, oxygen, and silver are uniformly distributed on the surface of the film. The mass fractions of carbon, oxygen, and silver, shown in the upper right corner of Figure 3G, are 68.48, 30.77, and 0.79%, respectively. The atomic number percentages are 74.70, 25.21, and 0.10%, respectively. The above results show that we have successfully reduced AgNP on the surface of PMMA/CA films in situ and prepared AgNP/PMMA/CA films, and the AgNP are uniformly distributed on the surface of the films.
      Figure thumbnail gr3
      Figure 3(A, C) The surface morphology of the AgNP/PMMA/CA film was observed by a scanning electron microscope, and the upper right corner of panel C is the particle size distribution of AgNP. (A) Scale bar = 3 μm; (C) scale bar = 1 μm; (B) the surface morphology of the PMMA/CA film, scale bar = 3 μm; (D–G) scanning electron microscope-mapping analysis of carbon, oxygen, and silver elements on the surface of films, scale bar = 800 nm. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate.

      Antibacterial Effect of AgNP/PMMA/CA Films

      The antibacterial effect of AgNP/PMMA/CA films against C. sakazakii was evaluated by measuring the inhibition zone size and growth kinetic curve. Figures 4A and 4B were the inhibition zone effects of AgNP/PMMA/CA films and PMMA/CA films on C. sakazakii, respectively, in which CA:PMMA (vol/vol) = 5:1. The results showed that AgNP/PMMA/CA films had an obvious antibacterial effect on C. sakazakii, whereas PMMA/CA films had no antibacterial effect on C. sakazakii. It showed that PMMA and CA in the film have no antibacterial effect, and the substances that play an antibacterial effect are AgNP. The good antibacterial properties of AgNP/PMMA/CA films are similar to the results in other studies,
      • Son W.K.
      • Youk J.H.
      • Park W.H.
      Antimicrobial cellulose acetate nanofibers containing silver nanoparticles.
      prepared a AgNP/CA nanofiber by electrospinning technology, which had powerful activity against S. aureus, E. coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae.
      • Beisl S.
      • Monteiro S.
      • Santos R.
      • Figueiredo A.S.
      • Sánchez-Loredo M.G.
      • Lemos M.A.
      • Lemos F.
      • Minhalma M.
      • De Pinho M.N.
      Synthesis and bactericide activity of nanofiltration composite membranes—Cellulose acetate/silver nanoparticles and cellulose acetate/silver ion exchanged zeolites.
      reported the bactericidal application of AgNP/CA film in water treatment and found that the membrane could kill 99.95% of E. coli in 210 min. Also,
      • Suteewong T.
      • Wongpreecha J.
      • Polpanich D.
      • Jangpatarapongsa K.
      • Kaewsaneha C.
      • Tangboriboonrat P.
      PMMA particles coated with chitosan-silver nanoparticles as a dual antibacterial modifier for natural rubber latex films.
      indicated that AgNP/PMMA film showed antibacterial activity against E. coli and S. aureus.
      • Borse S.
      • Temgire M.
      • Khan A.
      • Joshi S.
      Photochemically assisted one-pot synthesis of PMMA embedded silver nanoparticles: Antibacterial efficacy and water treatment.
      synthesized an Ag-PMMA nanocomposite, which showed good antibacterial performance against gram-negative E. coli, P. aeruginosa, and gram-positive S. aureus, and had a good application prospect in the field of water treatment.
      Figure thumbnail gr4
      Figure 4(A) The inhibition zones of AgNP/PMMA/CA film against Cronobacter sakazakii; (B) the inhibition zones of PMMA/CA film against C. sakazakii; (C) the inhibition zone size of AgNP/PMMA/CA films with different CA:PMMA ratios, (D) growth kinetics of C. sakazakii treated with AgNP/PMMA/CA film or PMMA/CA film. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate; IFM = infant formula milk; LB = Luria-Bertani; values are mean ± SD for n = 3, 1-way ANOVA. *P < 0.05 compared with the control.
      Supplemental Figure S1 (https://data.mendeley.com/datasets/94b2m8jpjy/1;
      • Li H.
      Preparation of AgNPs/PMMA/CA film and its inhibitory effect on Cronobacter sakazakii in infant formula milk. Mendeley Data, V1.
      ) and Figure 4C showed the results of the inhibition zone of AgNP/PMMA/CA films with different CA:PMMA ratios. The results in Figure 4C show that when CA:PMMA (vol/vol) = 5:1, the antibacterial effect of AgNP/PMMA/CA films is the best. Therefore, CA:PMMA (vol/vol) = 5:1 was chosen to prepare AgNP/PMMA/CA films for subsequent determination of growth kinetics curves. The growth kinetic curves of C. sakazakii under different treatment conditions are shown in Figure 4D. Silver nanoparticles/PMMA/CA films have a significant inhibitory effect on the growth of C. sakazakii in both LB and IFM medium. The AgNP/PMMA/CA film can prolong the lag phase of the growth curve of C. sakazakii from 2 to 8 h. However, PMMA/CA films had no inhibitory effect on the growth of C. sakazakii, which was consistent with the results of the inhibition zone. However, the growth of C. sakazakii in IFM medium is better than that in LB medium. We speculated that the nutrients in IFM are richer than LB, and beneficial for the growth of C. sakazakii, so C. sakazakii can adapt to the stress of AgNP/PMMA/CA films faster. Additionally, some studies have pointed out that IFM contains lactose, protein, and lipids, which help C. sakazakii survive longer under environmental stress (
      • Lin L.-C.
      • Beuchat L.R.
      Survival of Enterobacter sakazakii in infant cereal as affected by composition, water activity, and temperature.
      ;
      • Dancer G.I.
      • Mah J.H.
      • Kang D.H.
      Influences of milk components on biofilm formation of Cronobacter spp. (Enterobacter sakazakii).
      ).

      Effects of AgNP/PMMA/CA Film Combined with Mild Heat Treatment on C. sakazakii

      The survival of C. sakazakii at different temperatures was evaluated as shown in Figure 5 and Table 2. At 45°C, the number of C. sakazakii in the control group and PMMA/CA film treatment group gradually increased, whereas AgNP/PMMA/CA film could significantly inhibit the growth of C. sakazakii in LB and IFM medium (Figures 5A and 5D). At 50°C, the growth of C. sakazakii in the control group and PMMA/CA film treatment group was inhibited, and the number of bacteria tended to be stable, whereas AgNP/PMMA/CA film could gradually reduce the survival rate of C. sakazakii in LB medium. In contrast, AgNP/PMMA/CA film did not reduce the number of C. sakazakii in IFM (Figures 5B and 5E), which indicated that C. sakazakii had higher survival ability in IFM. At 55°C, AgNP/PMMA/CA film can inactivate C. sakazakii in a shorter time than the control group and PMMA/CA film treatment group. In LB and IFM medium, AgNP/PMMA/CA film could inactivate C. sakazakii within 30 min and 120 min, respectively (Figures 5C and 5F). Consistent with previous results, the survival ability of C. sakazakii in IFM was higher than that in LB. We speculate that the richer nutrient content of IFM can improve the viability of C. sakazakii. This is consistent with the results of the growth curve in Figure 4D, C. sakazakii grows better in IFM medium. Many studies have shown that the composition of the medium affects bacterial growth and that IFM contains lactose, proteins, and lipids that protect bacterial cells from being lysed during drying and heating (
      • Lin L.-C.
      • Beuchat L.R.
      Survival of Enterobacter sakazakii in infant cereal as affected by composition, water activity, and temperature.
      ;
      • Dancer G.I.
      • Mah J.H.
      • Kang D.H.
      Influences of milk components on biofilm formation of Cronobacter spp. (Enterobacter sakazakii).
      ).
      Figure thumbnail gr5
      Figure 5The survival curve of Cronobacter sakazakii in different culture media combined with the following different temperatures: LB + 45°C; LB + 50°C; LB + 55°C; IFM + 45°C; IFM + 50°C; IFM + 55°C. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate; IFM = infant formula milk; LB = Luria-Bertani; ND = no cells were detected. Error bars represent the SD (n = 3).
      Table 2Combined effects of AgNP/PMMA/CA film and mild heat on Cronobacter sakazakii
      AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate.
      Culture

      condition
      LB
      LB = Luria-Bertani.
      IFM
      IFM = infant formula milk powder.
      ControlPMMA/CA filmAgNP/PMMA/CA filmControlPMMA/CA filmAgNP/PMMA/CA film
      Temperature45°C
      Time (min)Log10 C. sakazakii (cfu/mL; mean ± SD)
       06.19 ± 0.046.17 ± 0.046.23 ± 0.036.17 ± 0.076.28 ± 0.056.31 ± 0.08
       106.26 ± 0.086.09 ± 0.136.08 ± 0.096.29 ± 0.116.26 ± 0.116.18 ± 0.06
       206.25 ± 0.086.23 ± 0.066.22 ± 0.156.36 ± 0.076.36 ± 0.076.24 ± 0.07
       306.30 ± 0.056.30 ± 0.056.10 ± 0.03
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      6.49 ± 0.05&6.38 ± 0.076.28 ± 0.02*&
       606.40 ± 0.036.46 ± 0.066.18 ± 0.10
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      6.75 ± 0.06&6.70 ± 0.02&6.31 ± 0.04
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
       906.85 ± 0.036.90 ± 0.036.30 ± 0.08
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      7.09 ± 0.09&7.09 ± 0.016.30 ± 0.09
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
       1207.31 ± 0.067.31 ± 0.036.44 ± 0.05
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      7.37 ± 0.067.24 ± 0.076.43 ± 0.06
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      Temperature50°C
      Time (min)Log10 C. sakazakii (cfu/mL; mean ± SD)
       06.26 ± 0.026.37 ± 0.106.36 ± 0.076.51 ± 0.06&6.49 ± 0.016.47 ± 0.07
       106.39 ± 0.026.30 ± 0.076.20 ± 0.086.51 ± 0.04&6.40 ± 0.016.50 ± 0.02&
       206.34 ± 0.116.36 ± 0.046.21 ± 0.056.43 ± 0.036.47 ± 0.056.46 ± 0.11&
       306.33 ± 0.016.22 ± 0.136.25 ± 0.126.43 ± 0.106.47 ± 0.106.43 ± 0.06
       606.25 ± 0.046.25 ± 0.105.96 ± 0.13
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      6.46 ± 0.036.43 ± 0.056.39 ± 0.05&
       906.24 ± 0.026.11 ± 0.115.89 ± 0.11*6.43 ± 0.026.38 ± 0.06&6.33 ± 0.06&
       1206.31 ± 0.046.12 ± 0.08*5.73 ± 0.04
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      6.37 ± 0.036.45 ± 0.01 &6.44 ± 0.03&
      Temperature55°C
      Time (min)Log10 C. sakazakii (cfu/mL; mean ± SD)
       06.34 ± 0.086.35 ± 0.066.30 ± 0.136.73 ± 0.04&6.71 ± 0.07&6.74 ± 0.05&
       105.76 ± 0.065.75 ± 0.033.63 ± 0.05*6.30 ± 0.04&6.31 ± 0.04&6.25 ± 0.02&
       205.26 ± 0.015.25 ± 0.022.98 ± 0.03*6.29 ± 0.02&6.32 ± 0.01&6.28 ± 0.01&
       305.17 ± 0.025.18 ± 0.03ND
      ND = no cells were detected.
      *
      6.33 ± 0.02&6.31 ± 0.02&6.30 ± 0.03&
       604.25 ± 0.134.35 ± 0.14ND*5.58 ± 0.02&5.60 ± 0.01&4.94 ± 0.02*&
       903.09 ± 0.113.41 ± 0.03ND
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      2.83 ± 0.102.65 ± 0.13&2.16 ± 0.22
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      &
       120NDNDND2.26 ± 0.37&2.16 ± 0.22&ND
      In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05). &In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      1 AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate.
      2 LB = Luria-Bertani.
      3 IFM = infant formula milk powder.
      4 ND = no cells were detected.
      * In a row, an asterisk indicates a significant difference between the PMMA/CA film group or the AgNP/PMMA/CA film group, compared with the control group (P < 0.05).
      # In a row, a number sign indicates that the PMMA/CA film group is significantly different, compared with the AgNP/PMMA/CA film group (P < 0.05).&In a row, an ampersand indicates that the LB group is significantly different, compared with the IFM group (P < 0.05); values are mean ± SD; n = 3; 1-way ANOVA.
      The above results show that AgNP/PMMA/CA film combined with thermal treatment can reduce the survival rate of C. sakazakii, and the survival ability of C. sakazakii in IFM is higher than that in LB. Therefore, in the preparation of IFM, the antibacterial film combined with mild heat treatment can accelerate the inactivation of C. sakazakii and effectively reduce the harm of foodborne pathogens.

      Effects of AgNP/PMMA/CA Film on the Expression of Environmental Tolerance-Related Genes in C. sakazakii

      Cronobacter spp. contaminates some foods, such as milk powder, due to its high tolerance to environmental stress. Therefore, the reducing environmental stress tolerance of Cronobacter can reduce the threat of foodborne pathogens to human health (
      • Begley M.
      • Hill C.
      Stress adaptation in foodborne pathogens.
      ). Herein, we investigated the effect of AgNP/PMMA/CA film on the expression of some environmental tolerance-related genes of C. sakazakii, in which the gene groEs and the gene mfla-1165 are closely related to the thermotolerance of C. sakazakii, and the gene groEs can encode a chaperone protein which can facilitate the refolding of misfolded or partially folded proteins (
      • Gottesman S.
      • Wickner S.
      • Maurizi M.R.
      Protein quality control: Triage by chaperones and proteases.
      ). In some reports, the gene groEs can encode a heat shock protein, which can improve the heat tolerance of bacteria (
      • Dong Z.
      • Chen X.
      • Cai K.
      • Shen P.
      • Tian K.
      • Jin P.
      • Liu X.
      • Wang Z.
      Overexpression of the Bacillus licheniformis GroES enhances thermotolerance of Bacillus subtilis WB600.
      ). The gene mfla-1165 is a biomarker related to the heat resistance of C. sakazakii, which is closely related to the heat resistance of C. sakazakii (
      • Riedel K.
      • Lehner A.
      Identification of proteins involved in osmotic stress response in Enterobacter sakazakii by proteomics.
      ). The results of RT-qPCR are shown in Figure 6A and 6B, and the expression of both groES and mfla-1165 was significantly downregulated by AgNP/PMMA/CA film. The genes phoP/phoQ, fur and grxB were confirmed to be related to acid resistance of Enterobacter (
      • Bearson S.
      • Bearson B.
      • Foster J.W.
      Acid stress responses in enterobacteria.
      ;
      • Ling N.
      • Zhang J.
      • Li C.
      • Zeng H.
      • He W.
      • Ye Y.
      • Wu Q.
      The glutaredoxin gene, grxB, affects acid tolerance, surface hydrophobicity, auto-aggregation, and biofilm formation in Cronobacter sakazakii..
      ), and RT-qPCR results (Figure 6C6J) showed that AgNP/PMMA/CA film could significantly reduce the expression of these genes. Furthermore, Hfq, DnaK, DnaJ, and OmpA have been shown to be involved in the survival of C. sakazakii under environmental stress (
      • Jameelah M.
      • Dewanti-Hariyadi R.
      • Nurjanah S.
      Expression of rpoS, ompA and hfq genes of Cronobacter sakazakii strain Yrt2a during stress and viable but nonculturable state.
      ). According to the RT-qPCR results (Figure 6G6J), AgNP/PMMA/CA film could significantly reduce the expression of these genes. The sigma subunit of RNA polymerase (RpoS) is a major regulator of C. sakazakii in response to general stress and can regulate metabolism to protect C. sakazakii survival under harsh conditions (
      • Alvarez-Ordóñez A.
      • Begley M.
      • Hill C.
      Polymorphisms in rpoS and stress tolerance heterogeneity in natural isolates of Cronobacter sakazakii..
      ). The rpoS gene regulates responses to various environmental stresses, including starvation, hyperosmolarity, high temperature, and low temperature (
      • Hengge-Aronis R.
      Back to log phase: σS as a global regulator in the osmotic control of gene expression in Escherichia coli..
      ). According to the above results, we speculate that AgNP/PMMA/CA film may reduce the survival rate of C. sakazakii in environments such as heat stress by affecting the production, metabolism, and gene expression of C. sakazakii.
      Figure thumbnail gr6
      Figure 6Fold changes in the transcription of stress tolerance-associated genes in Cronobacter sakazakii in response to AgNP/PMMA/CA film. (A) The mRNA expression levels of C. sakazakii cultured in LB supplemented with AgNP/PMMA/CA film. (B) Heat map of the mRNA expression change. AgNP = silver nanoparticles; PMMA = polymethylmethacrylate; CA = cellulose acetate; values are mean ± SD for n = 3, one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001 compared with the control.

      Amount of Silver Transferred from AgNP/PMMA/CA Film into the Aqueous Solution

      According to Supplemental Figure S2 (https://data.mendeley.com/datasets/94b2m8jpjy/1;
      • Li H.
      Preparation of AgNPs/PMMA/CA film and its inhibitory effect on Cronobacter sakazakii in infant formula milk. Mendeley Data, V1.
      ), the amount of silver migration from the film into water increased with the passage of time, but the growth rate gradually slowed down, and the migration of silver within 7 d was lower than the maximum migration of nonapproved substances through functional barriers; as stipulated by the European Commission, the limit is 10 μg/kg (
      • Gallocchio F.
      • Cibin V.
      • Biancotto G.
      • Roccato A.
      • Muzzolon O.
      • Carmen L.
      • Simone B.
      • Manodori L.
      • Fabrizi A.
      • Patuzzi I.
      • Ricci A.
      Testing nano-silver food packaging to evaluate silver migration and food spoilage bacteria on chicken meat.
      ). Therefore, the AgNP/PMMA/CA film is not only used for antibacterial surface coating, but also has application prospects in food packaging and other fields. However, there are still some controversies about the application of AgNP in the food field; because silver is a heavy metal, its accumulation in the human body may cause harm to human health (
      • Tripathi N.
      • Goshisht M.K.
      Recent advances and mechanistic insights into antibacterial activity, antibiofilm activity, and cytotoxicity of silver nanoparticles.
      ). In this study, although AgNP were loaded onto the PMMA/CA film surface and only a small amount of silver migrated into the food matrix, the migration of silver into the food was still a potential hazard, and how to reduce the migration of silver (or prevent migration of silver) is one of the directions for future research.

      CONCLUSIONS

      We successfully prepared an AgNP-loaded polymer material film (AgNP/PMMA/CA film), and evaluated the inhibitory effect of the film on C. sakazakii. The results showed that AgNP/PMMA/CA film had a good inhibitory effect on C. sakazakii in both LB medium and IFM medium. AgNP/PMMA/CA film combined with heat treatment at 55°C could inactivate C. sakazakii in LB and IFM within 30 and 120 min, respectively. The results showed that the viability of C. sakazakii in IFM was higher than that in LB medium. Further studies showed that AgNP/PMMA/CA film could reduce the thermotolerance of C. sakazakii under heat stress by inhibiting the expression of environmental tolerance-related genes. Therefore, in the preparation of IFM, the antibacterial film combined with mild heat treatment can accelerate the inactivation of C. sakazakii and effectively reduce the harm of foodborne pathogens. Therefore, we believe that AgNP/PMMA/CA film has broad application prospects in food packaging material or antibacterial surface coating, and AgNP/PMMA/CA film can reduce the number of bacteria and inhibit their growth.

      ACKNOWLEDGMENTS

      The work was supported by the Research Foundation from Academic and Technical Leaders of Major Disciplines in Jiangxi Province, China (20194BCJ22004) and Research Project of State Key Laboratory of Food Science and Technology, Nanchang University, China (SKLF-ZZB-202133). Author contributions are as follows: Hui Li: conceptualization, methodology, writing original draft, software; Xiaoyan Feng: methodology, writing—review and editing; Xianxiang Zeng: writing—review and editing, investigation, supervision; Qixiu You: visualization, investigation; Wen Li: visualization, writing—review and editing; Hengyi Xu: conceptualization, project administration, resources, writing—review and editing. The authors have not stated any conflicts of interest.

      REFERENCES

        • Alt V.
        • Bechert T.
        • Steinrücke P.
        • Wagener M.
        • Seidel P.
        • Dingeldein E.
        • Domann E.
        • Schnettler R.
        An in vitro assessment of the antibacterial properties and cytotoxicity of nanoparticulate silver bone cement.
        Biomaterials. 2004; 25 (15046929): 4383-4391
        • Alvarez-Ordóñez A.
        • Begley M.
        • Hill C.
        Polymorphisms in rpoS and stress tolerance heterogeneity in natural isolates of Cronobacter sakazakii..
        Appl. Environ. Microbiol. 2012; 78 (22447602): 3975-3984
        • Amalaradjou M.A.R.
        • Venkitanarayanan K.
        Effect of trans-cinnamaldehyde on reducing resistance to environmental stresses in Cronobacter sakazakii..
        Foodborne Pathog. Dis. 2011; 8 (21114424): 403-409
        • Bearson S.
        • Bearson B.
        • Foster J.W.
        Acid stress responses in enterobacteria.
        FEMS Microbiol. Lett. 1997; 147 (9119190): 173-180
        • Begley M.
        • Hill C.
        Stress adaptation in foodborne pathogens.
        Annu. Rev. Food Sci. Technol. 2015; 6 (25665171): 191-210
        • Beisl S.
        • Monteiro S.
        • Santos R.
        • Figueiredo A.S.
        • Sánchez-Loredo M.G.
        • Lemos M.A.
        • Lemos F.
        • Minhalma M.
        • De Pinho M.N.
        Synthesis and bactericide activity of nanofiltration composite membranes—Cellulose acetate/silver nanoparticles and cellulose acetate/silver ion exchanged zeolites.
        Water Res. 2019; 149 (30447527): 225-231
        • Bhat D.K.
        • Kumar M.S.
        Biodegradability of PMMA blends with some cellulose derivatives.
        J. Polym. Environ. 2006; 14: 385-392
        • Borse S.
        • Temgire M.
        • Khan A.
        • Joshi S.
        Photochemically assisted one-pot synthesis of PMMA embedded silver nanoparticles: Antibacterial efficacy and water treatment.
        RSC Advances. 2016; 6: 56674-56683
        • Chen Y.
        • Wen Q.
        • Chen S.
        • Guo D.
        • Xu Y.
        • Liang S.
        • Xia X.
        • Yang B.
        • Shi C.
        Effect of thymoquinone on the resistance of Cronobacter sakazakii to environmental stresses and antibiotics.
        Food Control. 2020; 109106944
        • Cheng J.
        • Lin X.
        • Wu X.
        • Liu Q.
        • Wan S.
        • Zhang Y.
        Preparation of a multifunctional silver nanoparticles polylactic acid food packaging film using mango peel extract.
        Int. J. Biol. Macromol. 2021; 188 (34343590): 678-688
        • Dancer G.I.
        • Mah J.H.
        • Kang D.H.
        Influences of milk components on biofilm formation of Cronobacter spp. (Enterobacter sakazakii).
        Lett. Appl. Microbiol. 2009; 48 (19413805): 718-725
        • Dong Z.
        • Chen X.
        • Cai K.
        • Shen P.
        • Tian K.
        • Jin P.
        • Liu X.
        • Wang Z.
        Overexpression of the Bacillus licheniformis GroES enhances thermotolerance of Bacillus subtilis WB600.
        Biotechnol. Biotechnol. Equip. 2018; 32: 1527-1532
        • Fernando S.
        • Gunasekara T.
        • Holton J.
        Antimicrobial nanoparticles: Applications and mechanisms of action.
        Sri Lankan Journal of Infectious Diseases. 2018; 8: 2
        • Gallocchio F.
        • Cibin V.
        • Biancotto G.
        • Roccato A.
        • Muzzolon O.
        • Carmen L.
        • Simone B.
        • Manodori L.
        • Fabrizi A.
        • Patuzzi I.
        • Ricci A.
        Testing nano-silver food packaging to evaluate silver migration and food spoilage bacteria on chicken meat.
        Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess. 2016; 33 (27147130): 1063-1071
        • Gemili S.
        • Yemenicioğlu A.
        • Altınkaya S.A.
        Development of cellulose acetate based antimicrobial food packaging materials for controlled release of lysozyme.
        J. Food Eng. 2009; 90: 453-462
        • Gottesman S.
        • Wickner S.
        • Maurizi M.R.
        Protein quality control: Triage by chaperones and proteases.
        Genes Dev. 1997; 11 (9106654): 815-823
        • Gouvêa D.M.
        • Mendonça R.C.S.
        • Soto M.L.
        • Cruz R.S.
        Acetate cellulose film with bacteriophages for potential antimicrobial use in food packaging.
        Lebensm. Wiss. Technol. 2015; 63: 85-91
        • Haider T.P.
        • Völker C.
        • Kramm J.
        • Landfester K.
        • Wurm F.R.
        Plastics of the future? The impact of biodegradable polymers on the environment and on society.
        Angew. Chem. Int. Ed. Engl. 2019; 58 (29972726): 50-62
        • Hengge-Aronis R.
        Back to log phase: σS as a global regulator in the osmotic control of gene expression in Escherichia coli..
        Mol. Microbiol. 1996; 21 (8885260): 887-893
        • Hunter C.J.
        • Petrosyan M.
        • Ford H.R.
        • Prasadarao N.V.
        Enterobacter sakazakii: An emerging pathogen in infants and neonates.
        Surg. Infect. (Larchmt.). 2008; 9 (18687047): 533-539
        • Jameelah M.
        • Dewanti-Hariyadi R.
        • Nurjanah S.
        Expression of rpoS, ompA and hfq genes of Cronobacter sakazakii strain Yrt2a during stress and viable but nonculturable state.
        Food Sci. Biotechnol. 2018; 27 (30263819): 915-920
        • Jiang Q.
        • Luo B.
        • Wu Z.
        • Wang X.
        Antibacterial composite paper with corn stalk-based carbon spheres immobilized AgNPs.
        Mater. Sci. Eng. C Mater. Biol. Appl. 2020; 113 (32487414)111012
        • Kadhim A.
        • Humud H.R.
        • Abd Al Kareem L.
        XRD and FTIR studies for Ag/PMMA nano composite thin films.
        International Journal of Computation and Applied Sciences. 2016; 1: 21-27
        • Kamal T.
        • Ahmad I.
        • Khan S.B.
        • Asiri A.M.
        Synthesis and catalytic properties of silver nanoparticles supported on porous cellulose acetate sheets and wet-spun fibers.
        Carbohydr. Polym. 2017; 157 (27987930): 294-302
        • Kendouli S.
        • khalfallah O.
        • Sobti N.
        • Bensouissi A.
        • Avci A.
        • Eskizeybek V.
        • Achour S.
        Modification of cellulose acetate nanofibers with PVP/Ag addition.
        Mater. Sci. Semicond. Process. 2014; 28: 13-19
        • Khan S.B.
        • Alamry K.A.
        • Bifari E.N.
        • Asiri A.M.
        • Yasir M.
        • Gzara L.
        • Ahmad R.Z.
        Assessment of antibacterial cellulose nanocomposites for water permeability and salt rejection.
        J. Ind. Eng. Chem. 2015; 24: 266-275
        • Lampel K.A.
        • Chen Y.
        Method for the isolation and detection of Enterobacter sakazakii (Cronobacter) from powdered infant formula.
        Int. J. Food Microbiol. 2009; 136 (19733413): 179-184
        • Li H.
        Preparation of AgNPs/PMMA/CA film and its inhibitory effect on Cronobacter sakazakii in infant formula milk. Mendeley Data, V1.
        • Lin L.-C.
        • Beuchat L.R.
        Survival of Enterobacter sakazakii in infant cereal as affected by composition, water activity, and temperature.
        Food Microbiol. 2007; 24 (17613375): 767-777
        • Ling N.
        • Forsythe S.
        • Wu Q.
        • Ding Y.
        • Zhang J.
        • Zeng H.
        Insights into Cronobacter sakazakii biofilm formation and control strategies in the food industry.
        Engineering (Beijing). 2020; 6: 393-405
        • Ling N.
        • Zhang J.
        • Li C.
        • Zeng H.
        • He W.
        • Ye Y.
        • Wu Q.
        The glutaredoxin gene, grxB, affects acid tolerance, surface hydrophobicity, auto-aggregation, and biofilm formation in Cronobacter sakazakii..
        Front. Microbiol. 2018; 9 (29459854): 133
        • Marrez D.A.
        • Abdelhamid A.E.
        • Darwesh O.M.
        Eco-friendly cellulose acetate green synthesized silver nano-composite as antibacterial packaging system for food safety.
        Food Packag. Shelf Life. 2019; 20100302
        • Namouchi F.
        • Smaoui H.
        • Fourati N.
        • Zerrouki C.
        • Guermazi H.
        • Bonnet J.
        Investigation on electrical properties of thermally aged PMMA by combined use of FTIR and impedance spectroscopies.
        J. Alloys Compd. 2009; 469: 197-202
        • Nazarowec-White M.
        • Farber J.
        Enterobacter sakazakii: A review.
        Int. J. Food Microbiol. 1997; 34 (9039558): 103-113
        • Petrochenko P.E.
        • Zheng J.
        • Casey B.J.
        • Bayati M.R.
        • Narayan R.J.
        • Goering P.L.
        Nanosilver-PMMA composite coating optimized to provide robust antibacterial efficacy while minimizing human bone marrow stromal cell toxicity.
        Toxicol. In Vitro. 2017; 44 (28739488): 248-255
        • Puls J.
        • Wilson S.A.
        • Hölter D.
        Degradation of cellulose acetate-based materials: A review.
        J. Polym. Environ. 2011; 19: 152-165
        • Rai M.
        • Yadav A.
        • Gade A.
        Silver nanoparticles as a new generation of antimicrobials.
        Biotechnol. Adv. 2009; 27 (18854209): 76-83
        • Riedel K.
        • Lehner A.
        Identification of proteins involved in osmotic stress response in Enterobacter sakazakii by proteomics.
        Proteomics. 2007; 7 (17380534): 1217-1231
        • Rolim W.R.
        • Pelegrino M.T.
        • de Araújo Lima B.
        • Ferraz L.S.
        • Costa F.N.
        • Bernardes J.S.
        • Rodigues T.
        • Brocchi M.
        • Seabra A.B.
        Green tea extract mediated biogenic synthesis of silver nanoparticles: Characterization, cytotoxicity evaluation and antibacterial activity.
        Appl. Surf. Sci. 2019; 463: 66-74
        • Sadeghnejad A.
        • Aroujalian A.
        • Raisi A.
        • Fazel S.
        Antibacterial nano silver coating on the surface of polyethylene films using corona discharge.
        Surf. Coat. Tech. 2014; 245: 1-8
        • Son W.K.
        • Youk J.H.
        • Park W.H.
        Antimicrobial cellulose acetate nanofibers containing silver nanoparticles.
        Carbohydr. Polym. 2006; 65: 430-434
        • Suteewong T.
        • Wongpreecha J.
        • Polpanich D.
        • Jangpatarapongsa K.
        • Kaewsaneha C.
        • Tangboriboonrat P.
        PMMA particles coated with chitosan-silver nanoparticles as a dual antibacterial modifier for natural rubber latex films.
        Colloids Surf. B Biointerfaces. 2019; 174 (30500743): 544-552
        • Tripathi N.
        • Goshisht M.K.
        Recent advances and mechanistic insights into antibacterial activity, antibiofilm activity, and cytotoxicity of silver nanoparticles.
        ACS Appl. Bio Mater. 2022; 5 (35358388): 1391-1463
        • Wang W.
        • Yu Z.
        • Alsammarraie F.K.
        • Kong F.
        • Lin M.
        • Mustapha A.
        Properties and antimicrobial activity of polyvinyl alcohol-modified bacterial nanocellulose packaging films incorporated with silver nanoparticles.
        Food Hydrocoll. 2020; 100105411