Advertisement

Prevalence, antimicrobial susceptibility, and antibiotic resistance gene transfer of Bacillus strains isolated from pasteurized milk

  • Zhengyuan Zhai
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China

    Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Chang Cui
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Xueli Li
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Juan Yan
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Erna Sun
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Chenyuan Wang
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Huiyuan Guo
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China

    Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China
    Search for articles by this author
  • Author Footnotes
    * Current address: College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China.
    Yanling Hao
    Correspondence
    Corresponding author
    Footnotes
    * Current address: College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China.
    Affiliations
    Key Laboratory of Functional Dairy, Co-constructed by Ministry of Education and Beijing Municipality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China

    Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083 China

    Department of Nutrition and Health, China Agricultural University, Beijing, 100193 China
    Search for articles by this author
  • Author Footnotes
    * Current address: College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China.
Open AccessPublished:November 15, 2022DOI:https://doi.org/10.3168/jds.2022-22199

      ABSTRACT

      Pasteurization is carried out in dairy industries to kill harmful bacteria present in raw milk. However, endospore-forming bacteria, such as Bacillus, cannot be completely eliminated by pasteurization. In this study, a total of 114 Bacillus strains were isolated from 133 pasteurized milk samples. Antibiotic susceptibility tests showed that the percentage of Bacillus with intrinsic resistance to ampicillin and penicillin were 80 and 86%, respectively. Meanwhile, some Bacillus isolates had acquired resistance, including trimethoprim-sulfamethoxazole resistance (10 isolates), clindamycin resistance (8 isolates), erythromycin resistance (2 isolates), and tetracycline resistance (1 isolate). To further locate these acquired resistance genes, the plasmids were investigated in these 16 Bacillus strains. The plasmid profile indicated that Bacillus cereus BA008, BA117, and BA119 harbored plasmids, respectively. Subsequently, the Illumina Novaseq PE150 was applied for the genomic and plasmid DNA sequencing. Notably, the gene tetL encoding tetracycline efflux protein was found to be located on plasmid pBC46-TL of B. cereus BA117. In vitro conjugative transfer indicated that pBC46-TL can be transferred into Bacillus invictae BA142, Bacillus safensis BA143, and Bacillus licheniformis BA130. The frequencies were of 1.5 × 10−7 to 1.7 × 10−5 transconjugants per donor cells. Therefore, Bacillus strains with acquired antibiotic resistance may represent a potential risk for the spread of antibiotic resistance between Bacillus and other clinical pathogens via horizontal gene transfer.

      Key words

      INTRODUCTION

      Bovine milk is highly nutritious and has a near-neutral pH (6.6–6.8), which can be a suitable growth medium for various bacteria including Enterobacteriaceae, Streptococcaceae, and Bacillaceae (
      • Bartoszewicz M.
      • Hansen B.
      • Swiecicka I.
      The members of the Bacillus cereus group are commonly present contaminants of fresh and heat-treated milk.
      ;
      • Quigley L.
      • O’Sullivan O.
      • Stanton C.
      • Beresford T.P.
      • Ross R.P.
      • Fitzgerald G.F.
      • Cotter P.D.
      The complex microbiota of raw milk.
      ). These bacteria can influence the quality and safety of fluid milk or fermented dairy products. During the dairy product manufacturing, most of these bacteria can be destroyed by pasteurization. However, endospore-forming bacteria, such as Bacillus cannot be completely eliminated (
      • Gopal N.
      • Hill C.
      • Ross P.R.
      • Beresford T.P.
      • Fenelon M.A.
      • Cotter P.D.
      The prevalence and control of Bacillus and related spore-forming bacteria in the dairy industry.
      ). It has been reported that Bacillus from pasteurized milk showed resistance to some antibiotics including ampicillin, lincomycin, erythromycin, and tetracycline (
      • Liu X.-Y.
      • Hu Q.
      • Xu F.
      • Ding S.-Y.
      • Zhu K.
      Characterization of Bacillus cereus in dairy products in China.
      ;
      • Zhao S.
      • Chen J.
      • Fei P.
      • Feng H.
      • Wang Y.
      • Ali M.A.
      • Li S.
      • Jing H.
      • Yang W.
      Prevalence, molecular characterization, and antibiotic susceptibility of Bacillus cereus isolated from dairy products in China.
      ). For example, Bacillus strains were isolated from pasteurized milk samples collected from dairies in France and showed resistance to penicillin or erythromycin (
      • Perrin-Guyomard A.
      • Soumet C.
      • Leclercq R.
      • Doucet-Populaire F.
      • Sanders P.
      Antibiotic susceptibility of bacteria isolated from pasteurized milk and characterization of macrolide-lincosamide-streptogramin resistance genes.
      ). Seventy Bacillus cereus strains were isolated form 258 pasteurized milk samples collected from 32 cities in China and most of the isolates were resistant to ampicillin (99%), penicillin (99%), and cefoxitin (95%;
      • Gao T.
      • Ding Y.
      • Wu Q.
      • Wang J.
      • Zhang J.
      • Yu S.
      • Yu P.
      • Liu C.
      • Kong L.
      • Feng Z.
      • Chen M.
      • Wu S.
      • Zeng H.
      • Wu H.
      Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Bacillus cereus isolated from pasteurized milk in China.
      ). Thus, it is necessary to assess the prevalence and antimicrobial susceptibility of Bacillus strains in pasteurized milk.
      In Bacillus, the resistance to antibiotics could be either intrinsic or acquired. Generally, genes encoding acquired antibiotic resistance are located on mobile genetic elements such as plasmids or transposons, which could lead to the spread of antibiotic resistance among Bacillus and other clinical pathogens via horizontal gene transfer (
      • Navaneethan Y.
      • Effarizah M.E.
      Prevalence, toxigenic profiles, multidrug resistance, and biofilm formation of Bacillus cereus isolated from ready-to eat cooked rice in Penang, Malaysia.
      ). The erythromycin resistance gene on plasmid pHT73 can be transferred from Bacillus thuringiensis ssp. kurstaki KT0 to B. cereus and Bacillus mycoides by conjugation (
      • Hu X.
      • Hansen B.M.
      • Eilenberg J.
      • Hendriksen N.B.
      • Smidt L.
      • Yuan Z.
      • Jensen G.B.
      Conjugative transfer, stability, and expression of a plasmid encoding a cry 1Ac gene in Bacillus cereus group strains.
      ). The tetracycline resistance gene tet(M) located on a Tn916-like transposon can be transferred from B. cereus R89 to Enterococcus faecalis JH2-2 and Staphylococcus aureus 8794RF by filter mating (
      • Agersø Y.
      • Jensen L.B.
      • Givskov M.
      • Roberts M.C.
      The identification of a tetracycline resistance gene tet (M), on a Tn916-like transposon, in the Bacillus cereus group.
      ). Therefore, Bacillus strains in pasteurized milk could act as donors or reservoirs for antibiotic resistance genes (ARG), which can be transferred to pathogenic bacteria (
      • von Wintersdorff C.J.
      • Penders J.
      • Van Niekerk J.M.
      • Mills N.D.
      • Majumder S.
      • Van Alphen L.B.
      • Savelkoul P.H.
      • Wolffs P.F.
      Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer.
      ). Moreover, European Food Safety Authority recommends that bacterial strains harboring transferable ARG should not be present in foods for human (
      • European Food Safety Authority
      Introduction of a qualified presumption of safety (QPS) approach for assessment of selected microorganisms referred to EFSA-opinion of the scientific committee.
      ). Thus, it is necessary to determine the transferability of ARG from Bacillus strains in pasteurized milk, which is crucial for preventing the spread of ARG via food chain.
      To assess the prevalence and antimicrobial susceptibility of Bacillus strains in pasteurized milk, 114 Bacillus strains were isolated and identified from the pasteurized milk collected from different regions in China between May 2019 and March 2020. Subsequently, the broth microdilution method was used to assess the antibiotic susceptibility profiles of these Bacillus strains. Some Bacillus isolates showed acquired resistance to trimethoprim-sulfamethoxazole, clindamycin, erythromycin, and tetracycline, respectively. Genomic and plasmid DNA sequencing indicated that a tetracycline resistance gene tetL was located on plasmid pBC46-TL in B. cereus BA117. Moreover, the plasmid pBC46-TL can be transferred into Bacillus invictae BA142, Bacillus safensis BA143, and Bacillus licheniformis BA130 by filter mating. Altogether, our results indicated that the prevalence and antimicrobial susceptibility of Bacillus strains isolated from pasteurized milk should be paid more attention to prevent the spread of ARGs.

      MATERIALS AND METHODS

      Because no live human or animal subjects were used in this study, no approval from IRB or IACUC was required.

      Sample Collection and Preparation

      To assess the prevalence of Bacillus in pasteurized milk products, 30 pasteurized milks (stored at 4°C and within the shelf life) were purchased from retail markets and supermarkets in Beijing, and 30 samples of pasteurized milk were provided by local dairy factories in Beijing between May 2019 and March 2020. Meanwhile, 73 raw milk samples were collected from local dairy farms in Beijing, Tianjin, Hebei, Henan, Jiangsu, Heilongjiang, and Inner Mongolia. All raw milk samples were collected from bulk tanks by staff with permission from the quality manager and filled into 50-mL sterile plastic tubes (Corning). These samples were kept on ice and transported to the laboratory within 24 h. To address the spore-forming Bacillus, the raw milks were pasteurized at 80°C for 10 min in the laboratory and kept below 4°C until analysis (
      • Griffiths M.
      • Phillips J.
      Incidence, source, and some properties of psychrotrophic Bacillus spp found in raw and pasteurized milk.
      ).

      Isolation and Identification of Bacillus Strains

      Bacillus strains were isolated according to National Food Safety Standard (

      China, H. M. o. 2014. National Food Safety Standard. Food Microbiological Examination: Bacillus cereus. The Hygiene Ministry of China.

      ) with minor modifications (
      • Kwon E.-A.
      • Lee J.-I.
      • Park J.W.
      • Kim S.-S.
      Application of comparative genomics in the development of DNA probes to detect Bacillus cereus and Bacillus subtilis..
      ). Briefly, 25-g samples were randomly collected from each pasteurized milk sample and put into a sterile blender jar with 225 mL of 0.85% sterile saline buffer, then homogenized for 2 min at high speed (10,000 to 12,000 rpm), followed by dilution until 10−5. An aliquot of 0.2 mL of each dilution was plated onto Mannitol-Egg-Yolk-Polymyxin Agar (AOBOX) and incubated at 30°C for 24 to 48 h. Pink colonies surrounded by a zone of precipitation were considered as presumptive B. cereus group strains, whereas yellow colonies without a zone of precipitation were considered as other Bacillus strains. Colonies on MYP plates were streaked onto Nutritional Agar plate and incubated at 30°C for 24 h before identification.
      Genomic DNA of Bacillus strains was extracted using a TIANamp Bacteria DNA Kit (TIANGEN) according to the manufacturer's instructions. Concentration and purity of the DNA were measured by a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). A 16S rDNA fragment was amplified by standard PCR using Q5 High-Fidelity DNA polymerase (NEB) and universal bacterial primers 27F and 1492R (
      • Lane D.
      16S/23S rRNA sequencing.
      ). The PCR products were sequenced by Sangon Biotech and analyzed by nucleotide blast ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ). The strains with high similarity to 16S rRNA sequence of the Bacillus reference strain (E-value = 0 and Max identity ≥98%) were regarded as Bacillus strains.

      Antibiotic Susceptibility Test

      The antimicrobial susceptibility of 114 Bacillus isolates were determined by the broth microdilution method using the Biofosun gram-positive panel (Fosun Diagnostics). The antimicrobial susceptibility test was carried out and interpreted according to the criteria of the Clinical and Laboratory Standards Institute CLSI-M45 (
      • Hindler J.A.
      • Richter S.S.
      ). The 13 antibiotic agents included ampicillin (0.12–4 μg/mL), penicillin (0.06–8 μg/mL), meropenem (0.12–16 μg/mL), erythromycin (0.12–16 μg/mL), clindamycin (0.12–16 μg/mL), ciprofloxacin (0.06–8 μg/mL), rifampicin (0.06–8 μg/mL), sulfamethoxazole-trimethoprim (0.06/1.15–8/152 μg/mL), vancomycin (0.12–16 μg/mL), tetracycline (0.25–32 μg/mL), chloramphenicol (0.5–64 μg/mL), gentamicin (0.5–64 μg/mL). Staphylococcus aureus ATCC 29213 was used as a quality control in Minimum Inhibitory Concentration determination.

      Plasmid DNA Extraction

      Plasmid DNA of Bacillus strains that exhibited acquired antibiotic resistance was extracted using EZNA Plasmid DNA Mini Kit (Omega Bio-Tek Inc.) according to the manufacturer's instructions. Overnight cultures were inoculated (1% vol/vol) into 10 mL of Nutritional Broth and incubated at 30°C and 180 rpm. When cell density reached an OD600 nm of 0.8, bacterial cells were collected by centrifugation at 6,000 × g for 10 min at 4°C for plasmid DNA extraction. Concentration and purity of the DNA were measured by a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). Plasmid DNA samples were analyzed by electrophoresis on 1% wt/vol agarose gel (
      • Pan Q.
      • Zhang L.
      • Li J.
      • Chen T.
      • Chen W.
      • Wang G.
      • Yin J.
      Characterization of pLP18, a novel cryptic plasmid of Lactobacillus plantarum PC518 isolated from Chinese pickle.
      ). A supercoiled DNA ladder (catalog no. 3585A, Takara) was used to estimate the size of supercoiled plasmid. Agarose gel was stained with Gel Red (Biotium) in 1 × TAE buffer for 15 min. Then the plasmid DNA on gel was visualized with UV light (302 nm wavelength) and photographed by the gel documentation system (UVP).

      Genome Sequencing and Detection of Antibiotic Resistance Genes

      Genomic and plasmid DNA were sequenced using Illumina NovaSeq PE150 at the Beijing Novogene Bioinformatics Technology Co. Ltd., respectively. Briefly, 1 µg of DNA per sample was fragmented by sonication to a size of 350 bp, then DNA fragments were end-polished, A-tailed, and ligated with the full-length adaptor for Illumina sequencing with further PCR amplification. At last, PCR products were purified (AMPure XP system) and libraries were analyzed for size distribution by Agilent2100 Bioanalyzer and quantified using real-time PCR. The library was sequenced by Illumina NovaSeq PE150. The raw data obtained by sequencing was filtered to obtain Clean Data. The genome assembly with Clean Data was performed by SOAP denovo software. The functions of the predicted protein-coding genes were annotated with the Clusters of Orthologous Groups database using the WebMGA. Antibiotic Resistance Genes Database and Comprehensive Antibiotic Resistance Database were used for the prediction of antibiotic resistance genes (
      • Liu B.
      • Pop M.
      ARDB—antibiotic resistance genes database.
      ;
      • Alcock B.P.
      • Raphenya A.R.
      • Lau T.T.
      • Tsang K.K.
      • Bouchard M.
      • Edalatmand A.
      • Huynh W.
      • Nguyen A.-L.V.
      • Cheng A.A.
      • Liu S.
      CARD 2020: Antibiotic resistome surveillance with the comprehensive antibiotic resistance database.
      ).

      Conjugative Plasmid Transfer by Filter Mating

      All bacterial strains used for conjugative plasmid transfer were listed in Table 1. Bacillus was grown in nutritional broth at 30°C. Lactobacillus was grown under anaerobic conditions at 37°C in a De Man-Rogosa-Sharpe medium. Escherichia coli was grown at 37°C in Luria Bertani broth. Transfer of tetracycline resistance gene tetL was determined by filter mating as described previously (
      • Hinnekens P.
      • Koné K.M.
      • Fayad N.
      • Leprince A.
      • Mahillon J.
      pXO16, the large conjugative plasmid from Bacillus thuringiensis serovar israelensis displays an extended host spectrum.
      ) with slight modification. Both donor and recipient stains were incubated at 30 or 37°C to reach OD600 nm of 0.8, respectively. Subsequently, 500 μL of donor and 500 μL of recipient were mixed well and passed through a 0.45-μm cellulose-nitrate membrane filter (Xingya). The filter was then collected and placed on a nonselective agar plate for 24 h. After mating, the filter was washed by 10 mL PBS. Cells were collected by centrifugation at 6,000 × g for 10 min at 4°C. Transconjugants were screened by plating serial dilutions of the mating cells on appropriate selection agar plates (Table 4). Antibiotics (Sigma-Aldrich) were added at the following final concentrations: 20 μg/mL of tetracycline for the donor strain BA117; 16 μg/mL of erythromycin for Bacillus recipient; 4 μg/mL of clindamycin for Bacillus recipient BA102, BA142, and BA143; 16 μg/mL of clindamycin for Bacillus recipient BA107, BA130, and BA131; 34 μg/mL of chloramphenicol for E. coli recipient; 8 μg/mL of chloramphenicol for Lactobacillus recipient, respectively. Each mating experiment included a plating control of donor and recipient cells on selective medium to assess the presence of potential spontaneous mutants. The transfer frequencies were calculated as the ratio of transconjugants per donor cells (T/D) at the end of the conjugation time. The transfer of tetracycline resistance gene tetL was confirmed by plasmid profiling and PCR.
      Table 1Bacterial strains used for conjugative plasmid transfer in this study
      StrainRelevant phenotype or genotype
      TETR = tetracycline resistance; CLIR = clindamycin resistance; ERYR = erythromycin resistance; CHLR = chloramphenicol resistance.
      Role in conjugative transferReference or source
      Bacillus cereus BA117Pasteurized milk isolate, TETRDonorThis study
      Bacillus invictae BA142Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus safensis BA143Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus paralicheniformis BA103Pasteurized milk isolate, CLIR, ERYRRecipientThis study
      Bacillus licheniformis BA130Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus licheniformis BA107Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus spp. BA131Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus pumilus BA102Pasteurized milk isolate, CLIRRecipientThis study
      Bacillus licheniformis BA123Pasteurized milk isolate, CLIR, ERYRRecipientThis study
      Escherichia coli Rosetta (DE3)F-ompT hsdSB(rB- mB-) gal dcm (DE3) pRARE (CamR)RecipientNovagen, Germany
      Lactobacillus paracasei sCAUH35-2Kefir isolate, CHLRRecipientLaboratory stock
      1 TETR = tetracycline resistance; CLIR = clindamycin resistance; ERYR = erythromycin resistance; CHLR = chloramphenicol resistance.

      Nucleotide Sequence Accession Numbers

      The genome sequence of B. cereus BA008, BA117, and BA119 was deposited at GenBank under the accession number PRJNA774561.

      RESULTS AND DISCUSSION

      Prevalence Analysis of Bacillus in Pasteurized Milk

      In this study, a total of 114 Bacillus strains were isolated from 133 pasteurized milk samples. These 114 isolates included 46 Bacillus cereus, 4 Bacillus licheniformis, 3 Bacillus subtilis, 2 Bacillus pumilus, 1 Bacillus invictae, 1 Bacillus paralicheniformis, 1 Bacillus safensis, 2 Bacillus toyonesis, and 54 other Bacillus strains as shown in Table 2. The isolation rate of Bacillus was over 93.33% in pasteurized milk samples from market and dairy factory in Beijing. This agrees with the findings that the prevalence of Bacillus was high (∼100%) in the pasteurized milk collected in China and Thailand (
      • Chitov T.
      • Dispan R.
      • Kasinrerk W.
      Incidence and diarrhegenic potential of Bacillus cereus in pasteurized milk and cereal products in Thailand.
      ;
      • Zhou G.
      • Liu H.
      • He J.
      • Yuan Y.
      • Yuan Z.
      The occurrence of Bacillus cereus, B. thuringiensis, and B. mycoides in Chinese pasteurized full fat milk.
      ). However, the prevalence of Bacillus was much lower in the milk samples pasteurized in the laboratory, which was 32.87% (24/73 samples). These findings were reasonable because the heat treatment of these raw milk samples was 80°C for 10 min, which was more sufficient than commercial pasteurization. In addition, post-pasteurization contamination along the milk-processing lines was possibly a source of Bacillus in pasteurized milk. For instance, B. cereus showed outstanding ability to adhere to stainless steel surfaces of dairy plant and form biofilm (
      • Kumari S.
      • Sarkar P.K.
      Bacillus cereus hazard and control in industrial dairy processing environment.
      ;
      • Silva H.O.
      • Lima J.A.S.
      • Aguilar C.E.G.
      • Rossi G.A.M.
      • Mathias L.A.
      • Vidal A.M.C.
      Efficiency of different disinfectants on Bacillus cereus sensu stricto biofilms on stainless-steel surfaces in contact with milk.
      ).
      Table 2Prevalence of Bacillus isolates in pasteurized milk
      IsolateType
      From the factory (n = 30)From the market (n = 30)Made in the laboratory (n = 73)
      Bacillus cereus22159
      Bacillus licheniformis004
      Bacillus paralicheniformis001
      Bacillus pumilus002
      Bacillus safensis001
      Bacillus subtilis003
      Bacillus toyonesis011
      Bacillus invictae001
      Other Bacillus
      Strain cannot be identified at species level by 16s rDNA sequencing.
      62226
      Total283848
      1 Strain cannot be identified at species level by 16s rDNA sequencing.
      In this study, the isolate rate of Bacillus cereus was 41.23% (46/114), indicating that B. cereus is a common contaminant of pasteurized dairy products. It has been reported that the environments for milk production, handling, and processing could introduce B. cereus into dairy products (
      • Cui Y.
      • Liu X.
      • Dietrich R.
      • Märtlbauer E.
      • Cao J.
      • Ding S.
      • Zhu K.
      Characterization of Bacillus cereus isolates from local dairy farms in China.
      ). The heat-stable B. cereus spores in raw milk and the post-pasteurization contamination along the milk-processing lines were major sources of B. cereus contamination in pasteurized milk (
      • Saleh-Lakha S.
      • Leon-Velarde C.G.
      • Chen S.
      • Lee S.
      • Shannon K.
      • Fabri M.
      • Downing G.
      • Keown B.
      A study to assess the numbers and prevalence of Bacillus cereus and its toxins in pasteurized fluid milk.
      ;
      • Gao T.
      • Ding Y.
      • Wu Q.
      • Wang J.
      • Zhang J.
      • Yu S.
      • Yu P.
      • Liu C.
      • Kong L.
      • Feng Z.
      • Chen M.
      • Wu S.
      • Zeng H.
      • Wu H.
      Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Bacillus cereus isolated from pasteurized milk in China.
      ). The growth of B. cereus limits the shelf life of pasteurized milk. In addition to the risk of causing spoilage, Bacillus strains from pasteurized milk showed resistance to some antibiotics, such as ampicillin, erythromycin, and tetracycline (
      • Liu X.-Y.
      • Hu Q.
      • Xu F.
      • Ding S.-Y.
      • Zhu K.
      Characterization of Bacillus cereus in dairy products in China.
      ;
      • Zhao S.
      • Chen J.
      • Fei P.
      • Feng H.
      • Wang Y.
      • Ali M.A.
      • Li S.
      • Jing H.
      • Yang W.
      Prevalence, molecular characterization, and antibiotic susceptibility of Bacillus cereus isolated from dairy products in China.
      ). Therefore, Bacillus strains not only influence the shelf life of pasteurized milk, but also might be reservoir of ARG.

      Antimicrobial Susceptibility Tests of Bacillus Isolates

      The 114 Bacillus isolates were tested for susceptibilities to 13 antibiotics using the broth microdilution method. All tested isolates were susceptible to the remaining 5 antibiotics, including meropenem, vancomycin, gentamicin, ciprofloxacin, and rifampin. A high percentage of the isolates were resistant to ampicillin (80%, 91/114) and penicillin (86%, 98/114). This is consistent with previous studies that most isolates of Bacillus cereus group were intrinsically resistant to β-lactam antibiotics (
      • da Silva Fernandes M.
      • Fujimoto G.
      • Schneid I.
      • Kabuki D.Y.
      • Kuaye A.Y.
      Enterotoxigenic profile, antimicrobial susceptibility, and biofilm formation of Bacillus cereus isolated from ricotta processing.
      ;
      • Yibar A.
      • Cetinkaya F.
      • Soyutemiz E.
      • Yaman G.
      Prevalence, enterotoxin production, and antibiotic resistance of Bacillus cereus isolated from milk and cheese.
      ) owing to β-lactamase production (
      • King D.T.
      • Sobhanifar S.
      • Strynadka N.C.J.
      The mechanisms of resistance to β-lactam antibiotics.
      ). However, the isolates identified as B. pumilus, B. safensis, and B. invictae were sensitive to both ampicillin and penicillin. These findings agree with 4 B. pumilus, 27 B. safensis, and 9 B. invictae isolated from different terrestrial sources and geographic locations were sensitive to both ampicillin and penicillin (

      Branquinho, R., J. Pires, M. M. Amorim, M. E. Pintado, and L. Peixe. 2015. Antibiotic resistance and virulence profile of Bacillus pumilus group members. in Proc. FEMS - 6th Congress of European Microbiologists.

      ). It is important to note that a few Bacillus isolates displayed acquired resistance to some antibiotics. Ten Bacillus isolates (9%) were resistant to trimethoprim-sulfamethoxazole (Figure 1). Eight strains were observed to be resistant to clindamycin. In addition, 2 isolates were resistant to erythromycin and 1 isolate named B. cereus BA117 was resistant to tetracycline (Table 3). Clindamycin, tetracycline, and erythromycin are frequently used for treatment of bovine mastitis in China (
      • Gao J.
      • Ferreri M.
      • Yu F.
      • Liu X.
      • Chen L.
      • Su J.
      • Han B.
      Molecular types and antibiotic resistance of Staphylococcus aureus isolates from bovine mastitis in a single herd in China.
      ). These antibiotics have been frequently found in cattle manure and wastewater (
      • Zhou L.-J.
      • Ying G.-G.
      • Liu S.
      • Zhang R.-Q.
      • Lai H.-J.
      • Chen Z.-F.
      • Pan C.-G.
      Excretion masses and environmental occurrence of antibiotics in typical swine and dairy cattle farms in China.
      ), which could create selective pressure for antibiotic-resistant Bacillus in dairy farms. The spores of these antibiotic-resistant Bacillus could be sources of contamination of raw milk. Notably, 14% (16/114) of the isolates exhibited multiple antibiotic resistance, which agrees with previous studies (
      • Cui Y.
      • Liu X.
      • Dietrich R.
      • Märtlbauer E.
      • Cao J.
      • Ding S.
      • Zhu K.
      Characterization of Bacillus cereus isolates from local dairy farms in China.
      ;
      • Gao T.
      • Ding Y.
      • Wu Q.
      • Wang J.
      • Zhang J.
      • Yu S.
      • Yu P.
      • Liu C.
      • Kong L.
      • Feng Z.
      • Chen M.
      • Wu S.
      • Zeng H.
      • Wu H.
      Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Bacillus cereus isolated from pasteurized milk in China.
      ). The antibiotic resistance of Bacillus isolates, especially acquired resistance, should be paid more attention to, as the acquired antibiotic resistance might be further transferred to other pathogens via horizontal gene transfer (
      • Zhu K.
      • Hölzel C.S.
      • Cui Y.
      • Mayer R.
      • Wang Y.
      • Dietrich R.
      • Didier A.
      • Bassitta R.
      • Märtlbauer E.
      • Ding S.
      Probiotic Bacillus cereus strains, a potential risk for public health in China.
      ).
      Figure thumbnail gr1
      Figure 1The proportions of susceptible, intermediate, and resistant strains among 114 isolated Bacillus strains tested against 13 antibiotics.
      Table 3Antibiotic resistance of 114 Bacillus isolates in the study
      For some organism or antimicrobial combinations, the absence or rare occurrence of resistant strains precludes defining any results categories other than “susceptible” (Hindler and Richter, 2016).
      CategoryAntibioticMIC (μg/mL) interpretive criteria
      S = susceptible; I = intermediate; R = resistant.
      Bacillus cereus (n = 47)Bacillus licheniformis (n = 4)Bacillus paralicheniformis (n = 1)Bacillus pumilus (n = 2)Bacillus safensis (n = 1)Bacillus subtilis (n = 3)Bacillus toyonesis (n = 1)Bacillus invictae (n = 1)Other Bacillus
      Strains identified as Bacillus spp. with BLAST search of 16S rRNA.
      (n = 54)
      SIR
      PenicillinsPenicillin≤0.12≥0.2547410011044
      Ampicillin≤0.25≥0.546210011040
      CarbapenemsMeropenem≤48≥16000000000
      GlycopeptidesVancomycin≤4000000000
      AminoglycosidesGentamicin≤48≥16000000000
      MacrolidesErythromycin≤0.51–4≥8001000001
      TetracyclinesTetracycline≤48≥16100000000
      FluoroquinolonesCiprofloxacin≤12≥4000000000
      LincosamidesClindamycin≤0.51–2≥4021110012
      Folate pathway inhibitorsTrimethoprim- sulfamethoxazole≤2/38≥4/76500000005
      PhenicolsChloramphenicol≤816≥32000000000
      AnsamycinsRifampin≤12≥4000000000
      1 For some organism or antimicrobial combinations, the absence or rare occurrence of resistant strains precludes defining any results categories other than “susceptible” (
      • Hindler J.A.
      • Richter S.S.
      ).
      2 S = susceptible; I = intermediate; R = resistant.
      3 Strains identified as Bacillus spp. with BLAST search of 16S rRNA.

      Plasmid Profile of Bacillus Strains with Multiple Antibiotic Resistance

      Antimicrobial resistance in bacteria is frequently encoded by genes carried on mobile genetic elements, in particular by plasmids (
      • Partridge S.R.
      • Kwong S.M.
      • Firth N.
      • Jensen S.O.
      Mobile genetic elements associated with antimicrobial resistance.
      ). The 16 Bacillus strains with acquired antibiotic resistance were tested for the presence of plasmids. The plasmid profile showed that 3 strains contained plasmids. B. cereus BA119, which was resistant to trimethoprim-sulfamethoxazole, had a 3.5 kb plasmid. Another trimethoprim-sulfamethoxazole resistant strain, B. cereus BA008, had a large plasmid with an apparent size of 10 kb. Notably, B. cereus BA117, which was resistant to tetracycline, had at least 5 plasmids differing in size from 3.5 to 10 kb. To further identify and locate these ARG, both genomic and plasmid sequencing were carried out using Illumina NovaSeq PE150.

      Detection of Antibiotic Resistance Genes by Genome and Plasmid Sequencing

      The draft genome of B. cereus BA008 was ∼5.2 Mb with a G + C content of 34.98%. A total of 5,436 genes were predicted with functional assignments. Moreover, 91 RNA genes were detected, consisting of 73 tRNAs, 13 rRNAs, and 5 sRNAs. The ARG were predicted by the ARG databases Antibiotic Resistance Genes Database and Comprehensive Antibiotic Resistance Database. Genes blaA, blaC, or bla1 encoding class-A β-lactamase and pbp2B encoding penicillin-binding protein 2B could confer BA008 resistance to β-lactam. Gene dfrA encoding drug-insensitive dihydrofolate reductase could confer BA008 resistance to trimethoprim. These were consistent with the results of the antimicrobial susceptibility test. The draft genome of B. cereus BA119 was ∼5.4 Mb with a G + C content of 35.29%. A total of 5,630 protein-coding genes, 12 rRNA genes, 95 tRNAs, and 17 genomic islands were predicted in the genome of BA119. The presence of various ARG were observed, including for β-lactam resistance (bla1, mecA, mecC, and pbp2B), trimethoprim resistance (dfrA), and sulfamethoxazole resistance (sul3). The draft genome of B. cereus BA117 was ∼6.5 Mb with a G + C content of 35.44%. We observed 7,078 predicted genes, including 106 tRNAs, 36 rRNAs, and 9 sRNA as well as 28 genomic islands. The ARG prediction indicated β-lactam resistance genes blaA and mecA, tetracycline resistance gene tetM, and tetL were present in B. cereus BA117.
      If these ARG are located on mobile genetic elements such as plasmids or integrative conjugative elements (ICEs), these genes will be easily transferred into other bacteria via horizontal gene transfer (
      • Huddleston J.R.
      Horizontal gene transfer in the human gastrointestinal tract: Potential spread of antibiotic resistance genes.
      ). Bioinformatics analysis indicated that the β-lactam resistance genes and trimethoprim or sulfamethoxazole resistance genes in BA008, BA117, and BA119 were located on the chromosome DNA. In addition, the tetracycline resistance gene tetM was also on the chromosome DNA of BA117. Moreover, ICE prediction with ICEberg 2.0 database indicated that these genes were not on mobile genetic elements (
      • Liu M.
      • Li X.
      • Xie Y.
      • Bi D.
      • Sun J.
      • Li J.
      • Tai C.
      • Deng Z.
      • Ou H.-Y.
      ICEberg 2.0: An updated database of bacterial integrative and conjugative elements.
      ). It is important to note that gene tetL was located on the 4.6 kb plasmid, which was designated as pBC46-TL. To further confirm the location of gene tetL, plasmid pBC46-TL was separated from other plasmids in B. cereus BA117 and purified by gel extraction (Figure 2A). A partial of tetL was obtained by PCR with purified pBC46-TL as a template, indicating that gene tetL was inside plasmid pBC46-TL (Figure 2B). The complete sequence of pBC46-TL was obtained by PCR amplification with the primer pair (TL-F: 5′- GCTGGTGCTGGAATGAGTTTG −3′ and TL-R: 5′- TTGGTTGTGTCGTAAATTCG −3′) and DNA sequencing. The sequence analysis showed that the gene encoding the Mob protein and a putative transfer origin sequence oriT were present in pBC46-TL (Figure 2C), indicating that this plasmid might be transferable via conjugation.
      Figure thumbnail gr2
      Figure 2(A) Agarose gel electrophoresis of plasmid pBC46-TL purified by gel extraction kit. Lane M: supercoiled DNA ladder (Takara). Lane 1: pBC46-TL. (B) Agarose gel electrophoresis of the PCR product of gene tetL. Lane M: DL2000 DNA ladder marker (Takara). Lane 1: DNA fragment of tetL, obtained by PCR with purified pBC46-TL as template. (C) The physical maps of plasmid pBC46-TL. Plasmid map was generated by SeqBuilder program of Lasergene v7.1 (DNASTAR Inc.). Closed arrows indicated open reading frames (orfs).

      Conjugative Transfer of the tetL Gene by Filter Mating

      The conjugative transfer capacities of the plasmid pBC46-TL were determined by filter mating using the tetracycline-resistant strain BA117 as donor. Eight Bacillus strains, 1 Escherichia coli strain, and 1 Lactobacillus paracasei strain were selected as recipients in this study (Table 1). Filter mating assays with BA117 (donor) and BA103 (recipient) revealed an average frequency of conjugation of 1.7 × 10−5 (Table 4). When comparing the plasmid profile of the transconjugant with the donor strain, we have observed that the transconjugant harbored a small plasmid (∼4.6 kb) of similar size to that of the donor strain (Figure 3). The tetL in the transconjugant was further confirmed by PCR amplification combined with DNA sequencing (data not shown).
      Table 4Frequencies of conjugative transfer with Bacillus cereus BA117 as donor
      Recipient strainAntibiotic for selection (μg/mL)Frequency
      The transfer frequencies were calculated as the ratio of transconjugants per donor cells (T/D) at the end of the conjugation time.
      Bacillus paralicheniformis BA103Tetracycline (20) + Erythromycin (16)1.7 × 10−5
      Bacillus invictae BA142Tetracycline (20) +Clindamycin (4)1.5 × 10−7
      Bacillus safensis BA143Tetracycline (20) +Clindamycin (4)2.0 × 10−6
      Bacillus licheniformis BA130Tetracycline (20) +Clindamycin (16)1.0 × 10−6
      Bacillus licheniformis BA107Tetracycline (20) +Clindamycin (16)0
      Bacillus spp. BA131Tetracycline (20) +Clindamycin (16)0
      Bacillus pumilus BA102Tetracycline (20) +Clindamycin (4)0
      Bacillus licheniformis BA123Tetracycline (20) +Erythromycin (16)0
      Escherichia coli Rosetta (DE3)Tetracycline (20) +Chloramphenicol (34)0
      Lactobacillus paracasei sCAUH35-2Tetracycline (20) +Chloramphenicol (8)0
      1 The transfer frequencies were calculated as the ratio of transconjugants per donor cells (T/D) at the end of the conjugation time.
      Figure thumbnail gr3
      Figure 3Plasmid profiles of donor, recipient, and transconjugant strains in experiment with Bacillus cereus BA117 as donor and Bacillus paralicheniformis BA103 as recipient. Lane M: supercoiled DNA ladder. Lane D: plasmid extracted from B. cereus BA117. Lane R: plasmid extracted from B. paralicheniformis BA103. Lane 1: plasmid extracted from the transconjugant.
      In addition, transfer of pBC46-TL to B. invictae BA142, B. safensis BA143, and B. licheniformis BA130 occurred at a frequency of 1.5 × 10−7 to 2.0 × 10−6 transconjugants per donor cells (T/D). However, no transconjugant was detected when the conjugative transfer of pBC46-TL was performed with B. licheniformis BA107, Bacillus spp. BA131, B. pumilus BA102, B. licheniformis BA123, Escherichia coli Rosetta (DE3), and Lactobacillus paracasei sCAUH35-2. These results revealed highly significant associations between transfer frequency and donor or recipient species, which was in accordance with previous studies (
      • Leroy S.
      • Christieans S.
      • Talon R.
      Tetracycline gene transfer in Staphylococcus xylosus in situ during sausage fermentation.
      ). Altogether, the filter mating experiments confirmed the transferability of tetL on plasmid pBC46-TL across some Bacillus strains, which might lead to the production of a new tetracycline-resistant strain in a natural environment.

      CONCLUSIONS

      A total of 114 Bacillus strains were isolated from 133 pasteurized milk samples. The antimicrobial susceptibility of these strains indicated that a high percentage of the isolates were intrinsically resistant to ampicillin and penicillin. Meanwhile, some Bacillus isolates displayed acquired resistance, including trimethoprim-sulfamethoxazole, clindamycin, erythromycin, and tetracycline. Subsequently, genomic and plasmid DNA sequencing were carried out to determine the ARG in plasmid-containing strains B. cereus BA008, BA117, and BA119. It is important to note that gene tetL encoding tetracycline efflux protein was located on the plasmid pBC46-TL of B. cereus BA117. This plasmid can be transferred into other Bacillus strains by filter mating. Therefore, Bacillus strains in pasteurized milk is not only of concern with regard to the spoilage of the products, but also might be a reservoir of ARG. Although the detection of Bacillus is not currently required for the dairy microorganism test of Chinese food security standards, prudent use of antibiotics, improved hygienic conditions during milking, and removing spores with bactofugation should be taken into consideration to reduce the antibiotic resistance of Bacillus in pasteurized milk.

      ACKNOWLEDGMENTS

      This work was supported by the National Key Research and Development Program of China (Beijing, China; grant number 2018YFC1604303) and Beijing Tongzhou Scientific and Technological Transformative Project (Beijing, China; grant number KJ2021ZH003). The authors have not stated any conflicts of interest.