If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
State Key Laboratory of Grassland Agro-ecosystems, International Centre of Tibetan Plateau Ecosystem Management, School of Life Sciences, Lanzhou University, Lanzhou 730000, ChinaKey Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, College of Animal Science, Guizhou University, Guiyang 550025, ChinaDepartment of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5, Canada
State Key Laboratory of Grassland Agro-ecosystems, International Centre of Tibetan Plateau Ecosystem Management, School of Life Sciences, Lanzhou University, Lanzhou 730000, China
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, College of Animal Science, Guizhou University, Guiyang 550025, China
Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Grønnegårdsvej 3, DK-1870, Frederiksberg C, Denmark
Desert Animal Adaptations and Husbandry, Wyler Department of Dryland Agriculture, Blaustein Institutes for Desert Research, Ben-Gurion University of the Negev, Beer Sheva 8410500, Israel
State Key Laboratory of Grassland Agro-ecosystems, International Centre of Tibetan Plateau Ecosystem Management, School of Life Sciences, Lanzhou University, Lanzhou 730000, China
Early-life gut microbial colonization and development exert a profound impact on the health and metabolism of the host throughout the life span. The transmission of microbes from the mother to the offspring affects the succession and establishment of the early-life rumen microbiome in newborns, but the contributions of different maternal sites to the rumen microbial establishment remain unclear. In the present study, samples from different dam sites (namely, oral, rumen fluid, milk, and teat skin) and rumen fluid of yak calves were collected at 6 time points between d 7 and 180 postpartum to determine the contributions of the different maternal sites to the establishment of the bacterial and archaeal communities in the rumen during early life. Our analysis demonstrated that the dam's microbial communities clustered according to the sites, and the calves' rumen microbiota resembled that of the dam consistently regardless of fluctuations at d 7 and 14. The dam's rumen microbiota was the major source of the calves' rumen bacteria (7.9%) and archaea (49.7%) compared with the other sites, whereas the potential sources of the calf rumen microbiota from other sites varied according to the age. The contribution of dam's rumen bacteria increased with age from 0.36% at d 7 to 14.8% at d 180, whereas the contribution of the milk microbiota showed the opposite trend, with its contribution reduced from 2.7% at d 7 to 0.2% at d 180. Maternal oral archaea were the main sources of the calves' rumen archaea at d 14 (50.4%), but maternal rumen archaea became the main source gradually and reached 66.2% at d 180. These findings demonstrated the potential microbial transfer from the dam to the offspring that could influence the rumen microbiota colonization and establishment in yak calves raised under grazing regimens, providing the basis for future microbiota manipulation strategies during their early life.
Colonization of gut microbiota during early life has a long-term impact on the host nutrient metabolism, immune system development and function, and the structure and function of the gastrointestinal tract in mammalian animals (
). Compared with the numerous studies on monogastric animals, research on early-life gut microbiota in ruminants is relatively scarce, especially for grazing animals. Recent studies have revealed that rumen bacteria and archaea are present in 1- to 3-d-old goat kids (
Presence of selected methanogens, fibrolytic bacteria, and proteobacteria in the gastrointestinal tract of neonatal dairy calves from birth to 72 hours.
), and that the predominant taxa and microbial diversity vary as the animals age. The early-life rumen microbiota of calves has also been reported to drive the development of the rumen, a key organ that determines ruminants' growth, health, and performance (
). The rumen development in newborn Holstein bull calves can be enhanced by the rumen microbiome through the regulation and expression of microRNA and genes that are negatively associated with the volatile fatty acids, important energy metabolites for the host (
). Thus, understanding the acquisition mechanisms of rumen microbes in neonates from various sources is vital for the development of manipulation strategies capable of regulating such processes and enhancing the rumen development and its function throughout the life span.
The factors shaping the succession and establishment of gut microbiota in early life have been widely studied, including the prenatal period, type of birth (cesarean section vs. vaginal delivery), feeding mode (
). Recently, social interactions with the mother have been proposed to play an important role in affecting the colonization and establishment of the early-life gut microbiota (
). In ruminants, the contribution of maternal microbiota from different body sites (vagina, colostrum, teat skin, feces, and oral) has been studied for early-life fecal microbiota composition of domesticated ruminants (goat, sheep, and dairy cow) raised under intensive systems (
Survey of rumen microbiota of domestic grazing yak during different growth stages revealed novel maturation patterns of four key microbial groups and their dynamic interactions.
). However, the knowledge of maternal microbial sources that contribute to the rumen microbiota of yak calves raised under grazing regimens (an open and not well-controlled animal rearing system) is still limited.
Yaks (Bos grunniens) possess many anatomical and physiological adaptations that enable them to survive in the harsh environment of the Tibetan plateau and to graze on the natural pasture all year without supplementary feed (
). Therefore, the current knowledge of the early-life rumen microbiota in domesticated ruminants may not be applicable to yaks. We hypothesized that the dam microbiota is one of the major sources that affects the development of the early-life rumen microbiota in grazing yak calves because they are raised together with their dams and depend on dam's milk for growth. Therefore, this study aimed to examine to what extent the dam microbiota contributed to the establishment of the rumen bacteria and archaea of the calf. To achieve this goal, rumen fluid samples from yak calves (grazing with their dams) were collected at 6 time points between d 7 and 180 after birth, and oral, teat skin, udder milk, and rumen fluid samples were collected from dams concomitantly to investigate how the microbes from the various sites contributed to the establishment of the rumen microbiota of grazing yak calves.
MATERIALS AND METHODS
Animal Experiment and Sample Collection
All experimental procedures were approved by the Animal Ethics Committee of the Chinese Academy of Lanzhou University (permit number SCXK Gan 20140215). A herd of pregnant yak cows (n = 30) that grazed together year-round in an alpine meadow on the Qinghai-Tibetan Plateau was enrolled in this study. From them, 7 lactating yak cows (5 to 6 years old; body weight 230 ± 16 kg; 3 to 4 parities) that calved male calves (15 ± 3 kg) between April 7 and 10, 2017, were selected for the study. The yak calves ran with their mothers and sucked milk until they were weaned naturally (till dam became pregnant). The overall sample collection scheme is shown in Figure 1. The yaks were corralled the night before sampling and the calves were separated from their dams immediately after corralling. The rumen fluid samples were collected from the lactating yak cows (referred to as dams throughout this paper) via mouth using a stainless-steel stomach tube connected to a rumen vacuum sampler before morning grazing, and from their calves at d 7, 14, 60, 90, 120, and 180 of age via mouth using a plastic flexible stomach tube attached with a vacuum sampler as described previously (Guo et al., 2020). The samples from the oral cavity, teat skin, and udder milk (referred to as oral, skin, and milk, respectively, hereafter) of the dams were collected concomitantly with rumen sampling of calves using methods of sample collection described by
. In brief, sterile swabs were used to collect samples from the upper area of the maternal teat (skin) and from the mouth (oral) and were placed into sterile plastic tubes. For the milk sample, the teat was cleaned with alcohol (75%) and then 13 mL of milk was collected, of which the first 3 mL was discarded. All samples were snap-frozen in liquid nitrogen immediately after collection and then stored at −80°C until DNA extraction.
Figure 1Flowchart describing the sample collection and approach used to profile the microbial community. Samples were taken from the rumen fluid, teat skin, oral cavity, and milk of the dams and from the rumen fluid of the calves from 7 dam-calf pairs. Sampling started at d 7 of age of the calf after birth and continued for up to 180 d. The yak calves ran with their mothers and sucked milk during the trial.
Genomic DNA was extracted using the PowerSoil DNA Isolation Kit (MoBio Laboratories) following the manufacturer's guidelines. The DNA extracted from frozen swabs followed the steps reported by
. Briefly, the head of each swab was removed and placed in a PowerBead tube with specimen-containing buffer, and then centrifuged at 1,000 g for 5 min for cell lysing. The DNA quantity, purity, and integrity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) and 1% agarose gel electrophoresis.
Amplicon Sequencing
To determine bacterial and archaeal profiles, the primer pairs Ba9f (GAGTTTGATCMTGGCTCAG) and Ba515Rmod1 (CCGCGGCKGCTGGCAC) targeting the bacterial partial 16S rRNA gene and the primer pairs Ar915aF (AGGAATTGGCGGGGGAGCAC) and Ar1386R (GCGGTGTGTGCAAGGAGC) targeting the archaeal partial 16S rRNA gene (
Global Rumen Census Collaborators Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range.
) were used to produce amplicons for each sample. The amplicon libraries were then sequenced on an Illumina PE MiSeq 300 platform to generate 2 × 300 bp paired-end reads at Majorbio Company.
Sequence Data Analysis
The raw sequences were analyzed using QIIME2 2020.2 (
), and then the qualified sequences were clustered into amplicon sequence variants (ASV). Taxonomy was assigned to the ASV against the SILVA 132 database (
The purple sea urchin Strongylocentrotus purpuratus demonstrates a compartmentalization of gut bacterial microbiota, predictive functional attributes, and taxonomic co-occurrence.
) and then the noninformative positions in the alignment were removed via “mask” command before the construction of the phylogenetic tree using the FastTree plugin (
). Last, clean reads were rarefied to lowest number of sequences within the data set (6,797 bacterial and 4,160 archaeal sequences) to avoid biases resulting from uneven sequencing depth before calculating the α (Shannon and Chao1) and β diversities (Bray-Curtis).
Determination of Sources of Calf Rumen Microbiota
SourceTracker2, a Bayesian approach that predicts the proportion of contaminants in a given community, was employed to determine the origin of microbes from the source environments (
) and assess the contributions of different maternal microbial sources to the yak calves' rumen microbiota after birth as described previously with the use of the sourcetracker2 (Guo et al., 2020). Samples collected from different maternal body sites were regarded as sources, and rumen fluid samples of calves were treated as sinks. This analysis was performed with default parameters within the SourceTracker2 software.
Statistical Analyses
Statistical differences in α diversity index among different sites within each age group were determined using the nonparametric Kruskal-Wallis test and P-values were adjusted using the Benjamini-Hochberg correction for Dunn's multiple comparisons (
). The adjusted P-value <0.05 was considered significant. Principal coordinates analysis based on Bray-Curtis distance was performed using the qiime2R package to compare the profiles of the microbial community among different sites and between yaks and calves (Guo et al., 2020). The pairwise PERMANOVA tested was used to test significance among sites with default permutations in QIIME2 (
). A taxon that appeared in at least 50% of the animals in one site within one age group, with a relative abundance >1% at the phylum and genus levels, was considered for further analysis. All statistical analyses were conducted in RStudio (v 3.5.3), unless otherwise noted.
Data Deposition
Sequencing data were deposited at the NCBI Sequence Read Archive under accession number PRJNA838115.
RESULTS AND DISCUSSION
Microbial Diversity of Bacterial Community Detected in Dams and Calves
Amplicon sequences were obtained from a total of 210 samples (168 from dams and 42 from calves). Forty-five samples for bacteria and 99 samples for archaea were removed due to the low quality of extracted DNA or no amplicon being obtained. The detailed sample numbers for each age group within each sample type are listed in Table 1.
Table 1Sample information and sequencing statistics obtained using the DADA2 algorithm in QIIME2
Bacteria were amplified successfully in a total of 165 samples from dams (rumen fluid: n = 33; milk: n = 31; oral: n = 30, teat skin: n = 37) and calves (rumen fluid: n = 34) between d 7 and 180 across 6 time points (Table 1). After quality control, a total of 3,191,878 high-quality reads were obtained for bacteria with an average of 19,345 ± 638 (mean ± SEM) per sample, which yielded a total of 43,871 ASV (674 ± 21 per sample). Good's coverage for each sample was higher than 96%, indicating that the sequencing depth was sufficient to characterize the microbial community in each site. The Shannon index of rumen bacteria in calves was lower than that of dams on d 7 and 14 (P < 0.05; Figure 2A), whereas the Chao1 index of rumen bacteria of calves was lower than that of milk and dams' rumen bacteria on d 7, and of oral bacteria on d 14 (P < 0.05; Figure 2A). This is consistent with studies on dairy cows and goats, where the milk bacteria diversity was much higher than those of calf rumen bacteria (
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
) and the fecal bacteria of goat kids (Guo et al., 2020). However, these studies did not compare the rumen microbiota of newborns to oral microbiota. Oral microbiota is an important source for the infant gut microbiota colonization (
), although the influence was short-lived (2 mo). Our results revealed that the effects of milk and the oral bacteria diversity of dams on the rumen bacterial diversity of yak calves in early life can be long term (6 mo).
Figure 2Alpha diversity of bacteria (A) and archaea (B) among different sites with age. Nonparametric Kruskal-Wallis and Duncan's tests were used to test for differences among different sites within each age group. A P-value <0.05 was accepted as significant. Means with different lowercase letters within an age group differ from each other (P < 0.05). The box plots show the median (dark line) and upper and lower quartiles. The whiskers display the minimum and maximum values, and the dots represent the outliers.
The comparison of β diversity of microbial communities with principal coordinates analysis and PERMANOVA based on the Bray-Curtis distance matrix revealed that bacteria of lactating yak cows were clustered according to the sites, and the rumen microbiota of the calves resembled the maternal rumen microbial community consistently, although there was a little fluctuation in the earlier days (e.g., d 7 and 14) (Figure 3A; Supplemental Table S1, https://doi.org/10.6084/m9.figshare.21077284;
). The rumen bacterial profiles of the calves clustered according to dam rumen bacteria, but they were more related to milk bacterial profiles than other sites on d 7 (P < 0.05; Figure 3A; Supplemental Table S2, https://doi.org/10.6084/m9.figshare.21077284;
). This observation is in line with the data presented by Guo et al. (2020), who showed the rumen bacterial community of goat kids in the early life clustered with that of the milk, and
, who observed a 20% sharing in microbial taxa between colostrum and fecal samples of dairy calves during the first 12 h after birth. Together, these suggest that milk bacteria are likely one of the inoculation sources for neonatal yak calf rumen because they were raised with the dams and fed mainly with dam's milk. As calves aged, the rumen bacterial community gradually clustered with the rumen bacteria of the dam (Figure 3A), and from d 90 it was more similar to the rumen bacteria of the dam than to any other site (Supplemental Table S2). This is similar to the findings for the rumen bacteria in dairy calves (
), where the similarity of rumen bacteria between calves and adult animals increased with age. In addition, the rumen gradually developed with age and performs similar functions to that of adult postweaning (
), which contributes to the high similarity in rumen microbiota between calves and dams.
Figure 3Bacterial (A) and archaeal (B) community structures at different sites within each age. Principal coordinates analysis (PCoA) based on Bray-Curtis distances.
Microbial Diversity of Archaeal Community Detected in Dams and Calves
Archaea were amplified successfully in a total of 111 samples from dams (rumen fluid: n = 28; oral: n = 27; teat skin: n = 27) and calves (rumen fluid: n = 29) between d 14 and 180 across 5 time points (Table 1), though they were not detected in the milk. A total of 1,008,207 high-quality reads were obtained for archaea with an average of 9,083 ± 268 per sample, which generated a total of 468 ASV (58 ± 3 per sample). The Shannon index of rumen archaea in calves was lower than that of skin archaea on d 14 and 60 (P < 0.05; Figure 2B), whereas the Chao1 index of rumen archaea in calves was lower than that of skin archaea at all tested ages (P < 0.05; Figure 2B). Previous studies have demonstrated that early rumen archaea colonization in dairy calves occurred at the first week after birth (
Presence of selected methanogens, fibrolytic bacteria, and proteobacteria in the gastrointestinal tract of neonatal dairy calves from birth to 72 hours.
). These findings suggest that the initial seeding of archaea in the rumen of natural grazing yaks differs from that of domesticated dairy cattle, which was only detected after d 14 of age. The detection of oral archaea also adds to the recent findings reported by other researchers who showed that archaea were commensal in the oral samples of Ayrshire cows (
), indicating that archaea are the essential inhabitants in the oral cavity of ruminants. Archaea were found on the teat skin in this study, which is in line with the study on dairy cows (
), in which archaea were found on the skin at the fore udder. In addition, archaea have been detected on human skin as well as on ruminants (bovine, sheep, and goat) and skin of different members of the class Mammalia (
), suggesting archaea may be commensal organisms on the skin of different animal species. However, the human skin archaea are distinct from those of nonhuman mammals (
), indicating that host species or living environment could affect the diversity and composition of the skin archaea.
The rumen archaeal community of calves clustered according to the dam rumen archaea and oral archaea after d 90 (P < 0.05; Figure 3B; Supplemental Table S2), which is supported by a previous study on yak rumen microbiota, where the rumen archaea community clustered with adult animals after 2 mo of age of the calves (Guo et al., 2020). As calves aged, they gradually changed their diet from milk to the natural grass that their dams consumed in this study, which contributes to the increased similarity in the rumen archaea with the age between calves and dam, as diet affects the archaeal community (
). In addition, rumen archaeal composition and function varied with age, and its community structure reached levels similar to those in adult animals after 2 mo (
). We reasoned that archaea from rumen and saliva are potentially important sources for the colonization and development of yak calf rumen archaea.
Bacterial Composition in Dam and Calves
A total of 36 bacterial phyla and 116 bacterial genera were identified according to the threshold mentioned in the materials and methods section. Among the detected taxa, 7 phyla were detected in the milk, with Proteobacteria (45.4% ± 0.02), Firmicutes (20.1% ± 0.01), Actinobacteria (17.9% ± 0.02), and Bacteroidetes (10.7% ± 0.01) being the predominant phyla (Figure 4A; Supplemental Table S3, https://doi.org/10.6084/m9.figshare.21077284;
). A total of 43 genera were treated as detectable, and Acinetobacter (8.8% ± 0.02), Corynebacterium 1 (4.7% ± 0.01), and Moraxella (4.3% ± 0.01) were found to be prevalent in the milk (Supplemental Data Set S1, https://doi.org/10.6084/m9.figshare.21077284;
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
), suggesting that these microbes are the core taxa in the milk produced by the different ruminant species. However, this result was not in agreement with those of goat and sheep milk, where Firmicutes was the most dominant phylum (
). The difference in milk microbial composition may be attributed to the host (ruminant species, stage of lactation, and health conditions) and environmental factors (e.g., farm environment, management, and diet) (
). By consuming oxygen, Proteobacteria modifies the rumen environment to create suitable anaerobic conditions that are favorable to the growth of strict anaerobes (
). Therefore, the prevalence of Proteobacteria in the milk may facilitate the colonization of the rumen microbiota in yak calves.
Figure 4Compositional profile of bacteria and archaea at the phylum level. (A) Bacterial phylum composition at different sites across ages. (B) Archaeal phylum composition at different sites across ages.
). However, this observation was not consistent with previous reports that researched the microbiome of cow and sheep milk, which contained a greater abundance of Lactococcus spp. (
), and the milk samples in this study were snap-frozen in liquid nitrogen, which partially explains this discrepancy. Other studies showed that Corynebacterium dominated in the milk of water deer (
). The differences in milk microbial composition in this study compared with the aforementioned research could be attributed to the host (breed, species, and health conditions) and environmental factors (temperature, humidity, and diet). Furthermore, some nonpathogenic Corynebacterium species are beneficial in the processing of dairy products, such as amino acid production and flavor improvement of cheese (
). Thus, the prevalence of Corynebacterium in the yak milk may contribute to its higher nutritious values (protein, polyunsaturated fatty acids, and fat) than that observed in cow milk (
The teat skin of yaks predominantly harbored bacteria phyla Proteobacteria (33.1% ± 0.02), Actinobacteria (25.3% ± 0.02), Firmicutes (21.3% ± 0.01), and Bacteroidetes (13.6% ± 0.01) from the 9 detected phyla (Figure 4A; Supplemental Table S3). At the genus level, 46 genera were detected, with Moraxella (12% ± 0.01), Corynebacterium 1 (11.6% ± 0.02), and Mannheimia (5.9% ± 0.01) being the predominant taxa (Supplemental Data Set S1). Corynebacterium has been reported to be prevalent in cattle teat skin (
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
). All these observations suggest that Corynebacterium belongs to the core microbiota in the skin and plays a critical role in maintaining the host health by activating skin immunity (
reported that Bacteroides and Prevotella dominated in the teat skin of ewes, and Romboutsia timonensis and Paeniclostridium sordellii were highlighted as the dominating taxa in cow teat skin (
Eight phyla were detected in the oral samples, and Firmicutes (51.4% ± 0.03), Proteobacteria (21.5% ± 0.03), Bacteroidetes (15.5% ± 0.02), and Actinobacteria (5.6% ± 0.01) were the predominant taxa (Figure 4A; Supplemental Table S3). This is consistent with the knowledge reported for the human oral microbiota, where Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria were the dominant taxa (
). At the genus level, 44 genera were detected, and Streptococcus (11.6% ± 0.02), Moraxella (7.04% ± 0.01), and f.Pasteurellaceae (4.3% ± 0.01) were prevalent in the oral samples (Supplemental Data Set S1). Previous studies demonstrated that Bacteroides and Prevotella were prevalent in the oral samples of ewes (
Nine and 8 phyla were detectable (appeared in at least 50% of the animals in one site within one age group and relative abundance >1%) in the rumen of calves and dams based on the selected criteria, respectively. Among them, Bacteroidetes (calf vs. dam: 53.9% vs. 49.6%) and Firmicutes (33.1% vs. 38%) were equally dominant in the rumen of calves and dams (Figure 4A; Supplemental Table S3). A total of 45 and 38 genera were referred to as detectable in the rumen of calves and dams, respectively. Of these, Prevotella 1 (10.5% ± 0.02), Prevotellaceae UCG-003 (8.4% ± 0.03), and Rikenellaceae RC9 gut group (8.1% ± 0.01) were dominant in the rumen of calves, whereas Rikenellaceae RC9 gut group (7.8% ± 0.03), Christensenellaceae R-7 group (6.6% ± 0.003), and Ruminococcaceae NK4A214 group (5.9% ± 0.005) were dominant in the rumen of dams (Supplementary Data Set 1). In addition, the relative abundances of Prevotella 1 and Rikenellaceae RC9 gut group in the rumen increased with the age of the calves, although there were fluctuations at d 90 or 120 (P < 0.05; Supplementary Data Set 1). It was reported that the relative abundance of Prevotella 1 correlated positively with the rumen weight and total VFA of goat kids (
). Therefore, we speculated that the changes in the relative abundance of these 2 genera may have contributed to the rumen development of yak calves, although the rumen morphology and structure were not examined in this study. Previous studies found that Rikenellaceae RC9 gut group was prevalent in the rumen of yak (Xue et al., 2018;
Nutritional interventions improved rumen functions and promoted compensatory growth of growth-retarded yaks as revealed by integrated transcripts and microbiome analyses.
). In addition, Rikenellaceae RC9 gut group played an important role in the digestion of crude fiber (Zhang, 2017). Therefore, these findings suggest that Rikenellaceae RC9 gut group is one of the core microbial taxa that perform basic metabolic functions in yak rumen.
Archaeal Composition in Dam and Calves
Taxonomic analysis revealed that 2 archaeal phyla and 11 archaeal genera were detected according to the selected criteria. Among them, Euryarchaeota (76.8% ± 0.03) and Thaumarchaeota (23.1% ± 0.03) were the dominant phyla in the teat skin (Figure 4B; Supplemental Table S3). Eight genera were regarded as detectable according to the criteria mentioned earlier, and Methanobrevibacter (61.7% ± 0.03), Candidatus Nitrocosmicus (12.5% ± 0.02), and f.Nitrososphaeraceae (9.8% ± 0.02) dominated in the teat skin (Supplemental Data Set S2; https://doi.org/10.6084/m9.figshare.21077284;
). Traditionally, it is believed that methanogen colonization in the skin appears to be transient or results from contamination by the external environment or the feces, as these microbes are strictly anaerobes (
). However, several studies support the hypothesis that the presence of archaea on the skin is not the mere result of an external colonization. It has been reported that Methanobrevibacter and Methanosphaera were the dominant taxa on the skin at the fore udder of dairy cows (
). Therefore, we speculated that archaea are the true members of the bovine skin microbiota herein and potentially play important roles in functions such as regulating the skin pH, although this area warrants further investigation.
Euryarchaeota (96.7% ± 0.01) was the most dominant phylum in the oral samples (Figure 4B; Supplemental Table S3). Among the 6 detected genera, Methanobrevibacter (81.9% ± 0.02), Methanosphaera (9.5% ± 0.01), and f.Methanobacteriaceae (2.2% ± 0.002) were the predominant archaeal taxa (Supplemental Data Set S2). It has been demonstrated that Methanobrevibacter dominated in the oral samples of Ayrshire cows (
), suggesting Methanobrevibacter is one of the core oral archaeal taxa in different animal species. In addition, oral microbiota is related to the host health conditions (
), and methanogenic archaea in the oral cavity with periodontal pathogens potentially act as terminal degraders of host components, supporting a continuous catabolic cascade (
). Future studies focusing on archaeal characterization are necessary for better comprehension of the composition and functions of this domain of life in different ruminant species.
Euryarchaeota (99.6% ± 0.002) was the most dominant phylum in the rumen of calves (99.3% ± 0.003) and dams (99.9% ± 0.001) (Figure 4B; Supplemental Table S3). Similarly, at the genus level, Methanobrevibacter (calf vs. dam; 78% ± 0.02 vs. 83.7% ± 0.01), Methanosphaera (5.8% ± 0.01 vs. 8.3% ± 0.01), and f.Methanobacteriaceae (5.4% ± 0.01 vs. 3% ± 0.01) were equally prevalent in the rumen of calves (9 detected genera) and dams (5 detected genera) (Supplemental Data Set S2). In addition, the dynamic change in the relative abundance of Methanobrevibacter and Methanosphaera in the rumen of calves was consistent with changes in the dams' rumen, oral samples, and skin (Supplemental Figure S1, https://doi.org/10.6084/m9.figshare.21077284;
). It has been reported that Methanobrevibacter and Methanosphaera dominated in the rumen of yaks, dairy cows, goats, and sheep (Wang et al., 2016; Guo et al., 2020;
), indicating that these methanogens are the core archaeal members in the rumen microbiota of different ruminant species.
Potential Maternal Sources for Rumen Bacteria in Calves
Bacteria from multiple maternal body sites contribute to the development of the rumen bacteria of calves, with maternal rumen bacteria proving the largest contribution (P < 0.05; Figure 5A). This was further supported by the higher proportion of taxa shared between the calf and the rumen of the dam than with other sites (Supplemental Figure S2A, https://doi.org/10.6084/m9.figshare.21077284;
). The contribution of different sites to the rumen bacteria of calves varied with age (Figure 5C). For example, the contributions of milk (2.7%) and skin (5.3%) to the rumen bacteria of the calves were numerically higher than for other sites (oral: 0.6%, dam: 0.2%) at d 7, and then decreased with the age (Figure 5C). These results indicate that the early bacterial colonization in the rumen is affected by the environment of site or source (
Figure 5Source Tracker depicting the proportion of rumen bacteria (A) and archaea (B) in yak calves originating from different maternal sites (milk, dam, oral cavity, and skin). (C) Proportion of rumen bacteria and archaea in yak calves originating from different maternal sites (milk, dam, oral, and skin) and for different age groups. Nonparametric Kruskal-Wallis and Duncan's tests were used to test for differences among sites within each age group. **P < 0.01; ***P < 0.001; ****P < 0.0001. The box shows the interquartile range below the first quartile and above the third quartile, and the line inside the box indicates the median. The whiskers indicate the minimum and maximum values, and the dots indicate outliers.
The proportion of rumen bacteria of calves that originated from milk bacteria was much lower than those of dam and oral samples (P < 0.05; Figure 5A), and it decreased with age (from 2.7% to 0.2%; Figure 5C). Milk from the dam not only is an important source of gut microbiota in newborn ruminants (
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
). These results are in contrast with the findings of this study, where the contribution of milk to the rumen microbiota of yak calves was only 0.7%. This is partially due to the low bacterial diversity (Shannon index) in milk in the early developmental stage compared with other maternal bacterial sources, such as the dam's rumen and oral cavity (
). In addition, the experimental period of d 7 to 180 in this study was longer than in the previous studies, where the contribution of colostrum microbiota to offspring gut microbiota decreased with age (
; Guo et al., 2020). Moreover, the present study started at 7 d of age, whereas the previous studies started immediately after birth when newborns were fed mainly milk. Consequently, the low contribution of milk to yak calves' rumen bacteria in the present study is not surprising.
The contribution of teat skin bacteria to the rumen bacteria of calves was less than that of other sites (1.4%, P < 0.05; Figure 5A) and it decreased with age (Figure 5C), supporting the evidence from a study on cattle and yaks in which the udder skin microbiota of suckling dams had low similarity to the calves' fecal microbiota (
). These results indicate that the udder skin microbiota contributes very little to the establishment of the whole gut microbiota of the infant. However, the dams' udder skin bacteria shared the largest similarity (23.9%) with the rumen bacteria of calves in the first 21 d of life (
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
). An obvious difference among the studies was that in the present study, the dams and calves were grazing, whereas in the other studies the dams and offspring were confined. The free-grazing calves had more contact with a more diverse microbiota present in the environment, likely reducing the chance of the udder skin microbiota surviving in the rumen of the calves. However, more research is needed on dams acquiring microbiota from grazing environments, as well as the transfer from the dam to the calf.
The oral bacteria of dams in the present study were an important inoculation source of rumen bacteria in the calves (Figure 5A), and its contribution increased with age (Figure 5C). It has been reported that the fecal microbiota in neonatal beef calves was closely related to the oral microbiota of adult cows (
), it is not surprising that the calves' rumen microbiota could be partially originated from the dams' oral microbiota. In addition, the percentage of shared species between the oral and gut of infants was very high (>20%) in a human study (
). These results suggest that continuous seeding of the microbiota in the infant gut via oral cavity is an important route for gut microbiota transfer and colonization in the early life. However, as the oral samples of newborns were not collected in the current study, future studies should take oral microbiota of neonatal calves into consideration to explore how the oral-gut axis in grazing yak calves affects the colonization of the rumen microbiota.
The contributions of the dams' rumen bacteria (0.2% to 14.8%) to the rumen bacteria of calves increased with age, with the dam providing the greatest contribution after 14 d of age when compared with other sites (P < 0.05; Figure 5C). This finding is similar to that of the human research indicating that mothers' gut microbiota contributed mostly to the establishment of the gut microbiota of the infants (
). The rumination of dams may contribute to the process of transfer from the rumen microbiota of dams to the rumen of calves through licking in the early life. On the other hand, the rumen microbiota of calves develops into a structure similar to that in dams postbirth that meets the functional requirements of the rumen, which plays an important role in shaping this transferring process.
Potential Maternal Sources for Rumen Archaea in Calves
The rumen archaea of the dam proved to be an important source of archaea to the calves' rumen, contributing approximately 48.4% of the rumen archaea, and its contribution was higher than that of other sites (oral and skin, P < 0.05; Figure 5B). The contribution of different sites to the rumen archaea of calves varied with age (Figure 5C). For example, the contribution of dam rumen archaea increased with age (30.2% to 66.2%, P < 0.05; Figure 5C), whereas that of oral archaea decreased with age (50.4% to 8.8%, P < 0.05; Figure 5C). The archaea from the skin contributed less to the rumen archaea of calves than other sites (P < 0.05; Figure 5B) but accounted for the highest proportion of shared taxa with the calf (Supplemental Figure S2B), and its contribution decreased with age (13.1% to 1.4%, P < 0.05; Figure 5C). Skin microbiota can be transferred to the calves while they are sucking. The calves gradually increase the ingestion of solid feed (natural grass) with age and reduce the frequency of sucking, thus lowering the contribution of the skin microbiota to the rumen archaeal population of the calf. In addition, the archaea microbes are strict anaerobes and cannot remain viable in the environment for a long time (
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
). In addition, methanogenesis plays a major role pertaining to the animal's energy-harvesting capability from the consumption and its effect on the environment (
). Given the importance of the rumen methanogens and the enormous significance of early-life gut microbiome manipulation for long-term host health and growth (
), future studies focused on comprehensively and deeply exploring the source of rumen archaea in the neonates and their functions in the early life are needed.
A limitation of the current study was that the maternal vaginal microbiota was not determined, and this site was reported to be an important source for the initial colonization of the gut microbiota in newborns, at least in human infants (
Molecular epidemiological study of vertical transmission of vaginal Lactobacillus species from mothers to newborn infants in Japanese, by arbitrarily primed polymerase chain reaction.
). Vaginal samples are very difficult to collect from the yaks immediately after calving, as they calve in the remote mountains of the Qinghai-Tibetan Plateau. However, perhaps collecting vaginal samples as soon as possible after calving might indicate the potential of microbiota transfer from the vagina to the calf. This practice is being planned for future studies.
CONCLUSIONS
This is the first study that investigated the potential maternal sources of microbiota to the rumen microbiota of yak calves from d 7 to 180 after birth. The microbial communities of dams clustered according to the sampling sites, which indicated that site-specific taxa existed at each sample site. The rumen bacteria of calves were derived mainly from the milk at d 7, suggesting the importance of milk bacteria to the colonization of rumen bacteria in calves during early life. Although the potential sources of rumen bacteria and archaea varied with the age of calves among sample sites, the rumen microbiota of calves tended to be composed mainly of microbiota from the rumen of dams. Results in the current study provided basic information on the transfer of bacteria and archaea from dam to calf under grazing conditions. These results might differ from those for animals raised in intensive or confined conditions; however, these latter animals could be used to examine microbiota development in the newborn under more controlled conditions.
ACKNOWLEDGMENTS
This study was funded by the National Natural Science Foundation of China (No. 31672453), China Scholarship Council, and was partially funded by Natural Sciences and Engineering Research Council of Canada (Edmonton, AB, Canada). The authors have not stated any conflicts of interest.
REFERENCES
Addis M.F.
Tanca A.
Uzzau S.
Oikonomou G.
Bicalho R.C.
Moroni P.
The bovine milk microbiota: Insights and perspectives from -omics studies.
Survey of rumen microbiota of domestic grazing yak during different growth stages revealed novel maturation patterns of four key microbial groups and their dynamic interactions.
Presence of selected methanogens, fibrolytic bacteria, and proteobacteria in the gastrointestinal tract of neonatal dairy calves from birth to 72 hours.
The purple sea urchin Strongylocentrotus purpuratus demonstrates a compartmentalization of gut bacterial microbiota, predictive functional attributes, and taxonomic co-occurrence.
Nutritional interventions improved rumen functions and promoted compensatory growth of growth-retarded yaks as revealed by integrated transcripts and microbiome analyses.
Molecular epidemiological study of vertical transmission of vaginal Lactobacillus species from mothers to newborn infants in Japanese, by arbitrarily primed polymerase chain reaction.
Biogeographical differences in the influence of maternal microbial sources on the early successional development of the bovine neonatal gastrointestinal tract.
00036-X&id=gr1.jpg){kind=link}
00036-X&id=gr2.jpg){kind=link}
00036-X&id=gr3.jpg){kind=link}
00036-X&id=gr4.jpg){kind=link}
00036-X&id=gr5.jpg){kind=link}